Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4697 precursor URS000075C16F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4697: MIR4697 is a long non-coding RNA (lncRNA) that has been identified as a key competing endogenous RNA (ceRNA) for miRNA-mRNA in lung adenocarcinoma [PMC5259593]. It has also been found to be upregulated in cancerous tissues compared to adjacent noncancerous tissues [PMC5769367]. In ovarian cancer cells, down-regulation of the MIR4697 host gene (MIR4697HG) promotes tumor growth and metastasis by reducing levels of matrix metalloproteinase-9, p-ERK, and phosphorylated AKT [PMC7027163]. In a study on a Chinese population, a significant association was found between a single nucleotide polymorphism (SNP) in MIR4697 (rs329648) and the susceptibility to Parkinson's disease [PMC6115491]. MIR4697 is one of the twelve loci that have shown genome-wide significant association with Parkinson's disease risk in multiple independent samples [PMC7369933]. Additionally, MIR4697 is one of the candidate PD-risk genes identified by a meta-analysis of genome-wide association studies [PMC6216208]. In lung adenocarcinoma, three differentially expressed lncRNAs have been revealed as prognostic biomarkers, including MIR4697 [PMC6471985]. Overall, these findings highlight the potential role of MIR4697 in cancer development and Parkinson's disease susceptibility.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCCAGAAGGGGGCGCAGUCACUGACGUGAAGGGACCACAUCCCGCUUCAUGUCAGUGACUCCUGCCCCUUGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications