v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HMMR antisense RNA 1 (HMMR-AS1) URS000075C0A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HMMR-AS1: HMMR-AS1 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including hepatocellular carcinoma (HCC) and glioma. In HCC, the expression of HMMR-AS1 was found to be significantly higher in Huh7 and Huh7-1.3 cell lines compared to normal liver cell line L02 [PMC9162001]. Inhibition of HMMR-AS1 expression was shown to significantly inhibit the growth of tumors in HCC [PMC5915996]. In glioma tissues, the expression of miR-7 was found to be negatively correlated with HMMR-AS1 expression [PMC8806593]. Additionally, it was found that miR-627-3p acts as an antagonistic mediator for HMMR-AS1 in HCC [PMC9162001]. The lncRNAs PANDA, RMST, and HOXA1 were shown to regulate translation mechanisms of mRNAs, while HMMR-AS1 is involved in mRNA stabilization and protein expression [PMC8733697]. In glioma patients, the level of HMMR-AS1 was used to divide patients into low and high groups for analysis [PMC8806593]. It is suggested that as a natural antisense transcript, rather than elevating it, HMMR-AS1 may act to stabilize the transcript of its sense counterpart (HMMR) [PMC5915996]. Overall, these findings highlight the role of HMMR-AS1 in cancer progression and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUCAGCAGCUGACAGAAUAAUCCACACAUUGGUUUCCUUACCUAUGGAGUGAGGGCUAUUAUGGUGGAAAAGGCCAAGUAGAAGCCACUAGAACUAUCUGUACUUAGGAAAAUAGUAAACCAAAAGCAAUGCUCAAUUCCUAUAGGGACUGAAGAGAUUAGUGCCACCAUAAGUACUUGAAGGAAGGCGGGGUGGUGAUUCCUACCAUAUGUCCAUUCAACUCGCCUAUUUAGCCUGGGCAGAAGACAGAUGGAUUAUCACAAACUUAACUAGGUGGUGACUCCAAUUGCAGCUACAGUACCAGAUGUAUUGCUUGAGCAAAUUAACACAACUCCUGGUUCCUGGUAUGCAGCUACCUGGAAUCUUGAUUGCCUUUUCUUUCCACAUCACAUUGGUCCAUUACAUUGACGACAUUAUGCUCACUGGACCUAAUGAGUGAGACAUAGCAACUACUCCAGACCUAUUGGAACUGACUUCACCUGCAACAGAGCUUGGAGAAGCUGAAGCCUAAGGGUGCUCUAAAGCAGGGGUCCCCAACCUCCGGGCUACAGACCAAUACCCAUCCAAGGCCUGUUAGGAACCCGGCUGCAGAGCAGGAGCUUUUCUGCAUGGAAGAAUUAAAUUGAGAAAAACAUAGUUAUUUAAAAAAUCACAUCGUAACUGAGUUAACAAGGCACUCAGGUUCUAAUCAUAGAUUACCUUCCUUCUUCAUCUUCCAGCUGUUUUCUAAAGUCUUCCUCCUGUUGCUUGAGUUGGUUCUGCAAAUCAGUUAUUUUUUGAAGAAAAGAAACUGUGAUUUCUUUAAUUUCUGUUUCCUUUAGUGCUGACUUGGUCUGCAGAUCUAGAAGCAUCCUUUGGUUUGAGAGAGAAGAGGUCACUAAACAUUUUAUAGCCACUUUCAUUAAUUUUUCCUUUUUUUUUCUUUAAACCUCAAGGAACUCUUCAAGAAGUGUCAUUUUUUAACUGAGUAAAUUCUUAAUUUGCAGUAUAAGAUGGCCAAAAGCAAGCCAAGGGACAGUUACUAGCUGGCUUUCAACAUUAAAUUGUCUUAAUGGUUCUAAGGCCAUUAUUUGCUCUAUAUACCUUACAUAUUCUUGAUUUGAGCUCUCAGUUGCCAAAAUCUGAUGCUGAACAUCCUCUGCAUUUUUCCCAGCCUUGGCCGCUUUUUCCUGUAAUGAUGAGUUCUCCAGCUUAAGAUCUUCUAUCUCACUGGCUGUUAACGCUUUAUAGCUUAUUAAAAAGAAAAAAAAGUCAAAGUAGUUUUCUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications