Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-21 precursor URS000075C097_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-21: Gga-mir-21 is a differentially expressed miRNA in chickens that has been studied in relation to its role in fighting against Infectious Bursal Disease Virus (IBDV) [PMC3700833]. To validate the Illumina small RNA deep sequencing data, five differentially expressed miRNAs, including gga-mir-21, were selected and their expression levels were quantified using real-time quantitative RT-PCR (qRT-PCR) [PMC3700833]. The study found that gga-mir-21 is upregulated in chickens as a defense mechanism against IBDV by inhibiting viral replication [PMC5097849]. This suggests that gga-mir-21 plays a role in the immune response to IBDV infection in chickens. The upregulation of gga-mir-21 may be a protective mechanism to limit viral replication and reduce the severity of the infection. This finding highlights the importance of miRNAs, such as gga-mir-21, in modulating immune responses and fighting against viral infections. Further research is needed to fully understand the mechanisms by which gga-mir-21 functions and its potential as a therapeutic target for IBDV infections [PMC5097849].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUACCAUCCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUCUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUUGGUAUCUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

Publications