v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-26b precursor URS000075C05A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR26B: MIR26B is a microRNA that has been found to play a role in the regulation of EZH2 expression [PMC6925750]. It has been suggested that the increase in EZH2 expression is due to the repression of microRNAs, including miR26a and MIR26B [PMC6925750]. Additionally, a specific region of gDNA, which includes MIR26B, has been identified and characterized. This region is 160 bp in length and is flanked by loxP sites, making it "floxed" [PMC8243710]. The identification of this specific region provides valuable information for further research on the role of MIR26B in gene regulation [PMC8243710]. The findings suggest that MIR26B may be an important factor in the regulation of EZH2 expression and could potentially be targeted for therapeutic interventions [PMC6925750]. Further studies are needed to fully understand the mechanisms by which MIR26B regulates gene expression and its potential implications in disease development and treatment [PMC6925750].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGACCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000001964.1)
  2. Callithrix jacchus mir-26 microRNA precursor family
  3. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000029486.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 26b (ENSCCAG00000003666.1)
  5. Cercocebus atys miRNA (ENSCATG00000009603.1)
  6. Chlorocebus sabaeus mir-26 microRNA precursor family
  7. Colobus angolensis palliatus miRNA (ENSCANG00000007086.1)
  8. Gorilla gorilla gorilla microRNA 26b (ENSGGOG00000033425.2)
  9. Gorilla gorilla mir-26 microRNA precursor family
  10. Macaca mulatta microRNA mml-mir-26b precursor
  11. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004006.1)
  12. Microcebus murinus (gray mouse lemur) microRNA 26b (ENSMICG00000029535.2)
  13. Pan paniscus (bonobo) microRNA 26b (ENSPPAG00000005657.1)
  14. Pan troglodytes ptr-mir-26b (ENSPTRG00000027661.3)
  15. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000038753.1)
  16. Pongo abelii (Sumatran orangutan) mir-26 microRNA precursor family
  17. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-26b precursor
  18. Rhinopithecus bieti miRNA (ENSRBIG00000011622.1)
  19. Rhinopithecus roxellana miRNA (ENSRROG00000009382.1)
  20. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000036364.1)
 Publications