v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 945 (LINC00945) URS000075C033_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00945: LINC00945 is a long non-coding RNA (lncRNA) that has been studied in the context of glioma, a type of brain tumor. Expression levels of LINC00945 were measured in normal human astrocyte and various glioma cell lines, as well as in glioma tissues derived from surgical specimens [PMC10064652]. Overexpression of LINC00945 was found to promote glioma cell proliferation, epithelial-mesenchymal transition (EMT), migration, invasion, and tumor growth in xenograft tumor models [PMC10064652]. The overexpression of LINC00945 was also associated with increased expression levels of N-cadherin, ZEB1, and ZEB2 proteins and mRNA [PMC10064652]. The epigenetic activation mechanism of LINC00945 was explored and its effect on glioma was investigated [PMC10064652]. In vitro experiments showed that overexpression of LINC00945 led to increased migration and invasion of glioma cells [PMC10064652]. In vivo xenograft models further demonstrated that LINC00945 promoted tumor proliferation [PMC10064652]. The expression levels of LINC00945 were found to be significantly up-regulated in glioma tissues compared to normal brain tissues [PMC10064652]. The role of LINC00945 has not been fully explored but it may serve as a potential therapeutic target for the treatment of glioma [PMC10064652]. The expression mechanism involves the regulation by MED1 and BRD4 proteins [PMC10064652]. Overall, these findings suggest that LINC00945 plays a role in promoting the progression and growth of gliomas.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CACGGUGUGGCCUCAGCAUCAGGGAUAUUUGCAACAUCCAUAUGGCUUCCAGAACAAGAGAGCAGGGAGGUCGGCAUCUACGAUUAAUAAGACAUAGAGAAGUCAUUCACCAGAAGUCCUCUUAGAAAAAGCAGUGCUUUUGACUGGAAAAGAAUGAUGAGUUGCAAAAGUAUGAUAGAGGAAACUGAGGUACUGACAGGUCAGAGCGCCUCCGAGAGAAAAAGGCGGUGGCCUUGGAGCUCUGGUCUCCUUAACUGCACCCUGGGAAGUCUUCACACGGCCUUUCUUCCCCUGGUGGUCUAAUCUGGAGUCAGAUCCAGCCGUCAGCUCUUACAGACGGGGAAGGACCGGGAGCCAACGGGAAAACAACAGGUUUCUAUAAUUCAUCAUUCACUCCUUUCUGAAAACCUAGAAUGAAAAAGUUUAGCAGCUCAGCGCCGCGGCCUCUCUCCAUUCUCUCCCCAAACACAUCGGCCUGUUUGUUCUCUUUCAUCCCCGCUCUUCCUGUUGCAUUCUGCCGGUUCAAUGGGGAAGGAGUGAAACCGGAUGGCUGGACCCAGUGCGGGGAAAUGACUUCAGAGCCACCUUUGUUUCCCUCAUUCCUUUGAGCGCACUUGGCCCUGCGUCUCUAUGAAAGGGCUUGUUUGAACCAUUCGGAACAUCCAGCAAGCCAGAGAUGCUGCGGCCAGAACCGCUCGCAUCUUUUCAGGCUGCCUGAGACUCUGGGUUAAACUGCCAAAUUUUUGCAACAAAACUAACCAUGACAUUGGACAUUGUGUUAUAAAUUAGCCACAGCCUUCCAAGCAAAUUGUCUCUUUUUAUUGUAUCAGUGUAAGCCUCGGAAACAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications