v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) progenitor renewal associated non-coding RNA (PRANCR) URS000075BF57_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PRANCR: PRANCR, a long non-coding RNA (lncRNA), has been studied for its association with partial indicators of HP, and 4 out of 11 SNPs were found to be significantly associated with these indicators [PMC8667444]. The influence of PRANCR on the stem cell potential of epidermal progenitors was evaluated, and differential expression analysis using DESeq identified 1136 differentially expressed genes (DEGs) in PRANCR knockdown cells [PMC6961571].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGCGGCAGCGGAAGGUGGGAGCGACGACUGCAAAACGGCAGCGAUGGGCUCCCGCAACCUCCGGAGCUUGUGCGCGUACUUCAGGGACCGGCACCACGUCACCGUCACCUCCUGAGUAGUCAAAAGCAAGAAAUAGGAAGAAACACAAGCAUACUAUAAAAUAAAAGUCUGAAAAUUCAAAAGAGAAGCAAUUUAAAGGACUUCCAUUUACUUCUUUCCCCUCUAAUCUGCACAAAAGGUUAAAUGUAGCAGUGCAGCAGUUCUGGCCAUCAAAAUAUGAUUAUUGUACUUUAAAAGCAGCCAUGAGAACUCUGCUCUUUGAUAGACUUCAACUUGCAACAACUAAGUAGUUUUUAUGGAACAGGUGGUGUUUGGUUAUGUGGAUAGGUUUUUUGGAAUACUACUCAGCCAUAAAACGGAACAAAAUAAUGGAAUUCCCAGCAACCUGGAUGGAGUCGGAGACCAUUAUUCUAAGUGAAGUAACUCAGUGAGAACAAAUAUCGUAUGUUCUCACUUAUAAGUGGGAGCUCUUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications