Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-98 precursor URS000075BF40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR98: MIR98 is a microRNA that has been implicated in breast cancer metastasis [PMC4653020]. In a study conducted on nude mice, MDA-MB-231 breast cancer cells infected with lentivirus carrying either MIR98 or a control (NC) were stimulated with CCL18, and their metastatic potential was evaluated [PMC4653020]. Among several microRNAs, including miR-18a, miR-21, miR-26a, miR-26b, miR-30b, MIR98 and miR-210, MIR98 was selected for further validation using Taqman quantitative RT-PCR [PMC3288043]. The study also found that when N-Ras is silenced in breast cancer cells, the ERK/PI3K/NFκB/Lin28b pathway is inactivated. This inactivation leads to the loss of Lin28b as an inhibitor of MIR98 and subsequently results in higher levels of MIR98. The increased levels of MIR98 further inhibit the expression of N-Ras [PMC4653020]. These findings suggest that reduction in MIR98 expression may contribute to enhanced breast cancer metastasis when stimulated by CCL18 [PMC4653020].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications