Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-31 precursor URS000075BF2D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-31: Mmu-mir-31 is a microRNA that is expressed in mice and is upregulated in response to M. bovis BCG infection [PMC4097432]. It has been found to have different isoforms, such as hsa-miR-31, ptr-miR-31, and mmu-mir-31, which have slight variations in their sequences [PMC3759948]. Mmu-mir-31 is one of the top miRNAs enriched in the mammary glands of pubertal mice and is expressed in all stages of development [PMC8944794]. It has been studied using microRNA real-time PCR amplification with TaqMan assays [PMC3510057]. Mmu-mir-31 has been used to generate transgenic mice for research purposes [PMC5648844]. The transcription start site for mmu-mir-31 has been determined using RNA sequencing data [PMC6291424]. The expression of mmu-mir-31 has been found to be upregulated in certain cells, such as Th1 cells and CD8+ T cells, and it plays a role in T cell dysfunction and exhaustion [PMC8602903]. Mmu-mir-31 has also been studied in the context of obesity, but its expression was not consistently found to be downregulated [PMC6001404][PMC3742134]. It has been shown to regulate the expression of various target genes involved in different biological processes [PMC3742134][PMC4077261][PMC7926522][PMC8602903][PMC3692539].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCCUGUAACUCGGAACUGGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGAGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCCUGUCUGACAGCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications