Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1249 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1249 precursor URS000075BEA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1249: MIR1249 is one of the top up-regulated genes in the study [PMC9279949]. It has been validated in different time points [PMC6006352]. Down-regulation of Dicer leads to decreased production of MIR1249 [PMC3316564]. MIR1249 inhibition can increase chemo-sensitivity by limiting the expansion of chemo-refractory cancer stem cells (CSCs) [PMC7590111]. MIR1249 is associated with the Wnt signaling pathway [PMC7590111]. MIR1249 expression is increased in response to chemotherapy treatment in human cholangiocarcinoma (CCA) cells [PMC7590111]. Inhibition of MIR1249 reduces the enrichment of CD133+ cells, while its enforced expression reduces sensitivity to chemotherapy [PMC7590111]. MIR1249 plays a role in driving the expansion of CSCs and is associated with worse prognosis independently of adjuvant chemotherapy in BTC patients [PMC7590111]. CD133+ BTC cells express higher levels of MIR1249 compared to CD133- cells, and its inhibition enhances BTC cell response to chemotherapy treatment [PMC7590111]. FZD8 is a potential target gene regulated by MIR1249, and its inhibition recapitulates the phenotype induced by MIR1249 mimic [PMC7590111].\n\nReferences:\n- PMC9279949\n- PMC6006352\n- PMC3316564\n- PMC7

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGAGGAGGGAGGAGAUGGGCCAAGUUCCCUCUGGCUGGAACGCCCUUCCCCCCCUUCUUCACCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Pan troglodytes miRNA
  2. Pongo abelii miRNA
  3. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1249 precursor
2D structure Publications