Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) G-quadruplex forming sequence containing lncRNA (GSEC) URS000075BEA1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GSEC: GSEC, also known as NONHSAT160878.1, is a G-quadruplex-containing long non-coding RNA (lncRNA) that has been implicated in the progression of pediatric sepsis [PMC8806204]. It is believed to regulate various signaling pathways, including the MAPK signaling pathway, TNF signaling pathway, Toll-like receptor signaling pathway, IL-17 signaling pathway, phagosome pathway, metabolic pathways, insulin signaling pathway, complement and coagulation cascades, and chemokine signaling pathway [PMC8806204]. These pathways are known to play important roles in the immune response and inflammation processes associated with sepsis. Additionally, GSEC has been found to interact with DHX36 and inhibit the unwinding activity of G-quadruplexes [PMC8578871]. This interaction has been shown to promote colon cancer cell metastasis [PMC8578871]. Overall, these findings suggest that GSEC may have a potential function in pediatric sepsis by modulating various pathways involved in immune response and inflammation [PMC8806204]. Furthermore, its interaction with DHX36 highlights its involvement in cancer progression as well [PMC8578871]. Further research is needed to fully understand the mechanisms by which GSEC contributes to these processes and its potential as a therapeutic target for sepsis or cancer treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAAGGGCGGGGUGGAGGAGGGGGAAGGGCGGGGGUGAUGCCGCGCGGUCGCAGGCUUGGGAUGGUGUUCGCGCCUCCGAGACCCGGACAGAGGCAAGCAGGGGCGCCGUGGGUGCCAGAGAGGCGGAAGAGGAGGCCUGAUGGGGAUACCUUCCUGCUGUCCUUCCUGAGCACAACCUGGCUGAAAACCUGGAGGUCACAACAGUACAAAGAAUCAAAGUCAAGAUCUUGUGCCAGAGAGCAAAUGAACUCUUCCUCUUGCUGAGAAAACCCACCCUGCUCACCUAAACCCUGGCCUUGCCUGGUAAUUCCAUCCAUGCGCCUGGAAGGCCCCAGACAUCAAGGCUCUGAGGGGCCAGGCACGGGGAGAACCCAGCAGUGCCCUGCCCUGCAGUCUGAGCUACCAGAUUCCUUGUGAAGAUAAUUUGAGGACCAUGACUCACCCAACCACAUUUCCUGGGGCCUCAAAUUGAAAAUUCAGGAUGGGCUUUUCUAUAUGACUGGCUGAUAUCCAACUAUGCCAUGGUCUUUACAUGCCAUGAACAUUCUUUCCUGCCAGAGUUCUAAGAAUCUGUGUUCUCUGCCUUAGACCUUCUGCAGAUGAGCCCACAGGAAGCUCCACGUGUAGCUGAGCUACAUGCACCAGGCCUCAGUUUGCCCCAAGUCCCCUGUGUACUCUCUCAUGGCCUGUGGCCAAGAAAUGUAUUCUCUCACUUUGGACUUAGGAGUCCAAAGAGAAGCCCAGAAACAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications