v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) NAV2 antisense RNA 4 (NAV2-AS4) URS000075BDC1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

NAV2-AS4: NAV2-AS4 is a long non-coding RNA (lncRNA) that has been studied in various contexts [PMC8167205]. It has been found to be located in the cytoplasm [PMC8167205]. In hepatocellular carcinoma (HCC), NAV2-AS4, along with other lncRNAs such as LINC02691, LINC02499, and LINC01354, has been shown to be significant in predicting overall survival (OS) [PMC8167205]. These lncRNAs have also been found to be positively correlated with SEC14L2 and SLC6A1 through the same miRNA, miR-212-3p [PMC8167205]. Furthermore, the expression of NAV2-AS4 in liver cancer tissues was significantly different compared to normal liver tissues [PMC8167205]. In another study, NAV2-AS4 was found to be suppressively expressed in a specific tumor group and strongly correlated with OS in HCC [PMC8167205]. Additionally, NAV2-AS4 was identified as a gene that significantly correlated with a benefit from surgery in HCC patients [PMC8674465]. It has also been implicated as a protective factor for liver hepatocellular carcinoma (LIHC) prognosis [PMC9354608]. Furthermore, NAV2-AS4 may be involved in preeclampsia (PE) through regulation of REN expression along with miR-6131 [PMC9123303]. However, the specific roles of NAV2-AS4 and miR-6131 in PE have not yet been elucidated [PMC9123303].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAUACAGGUUGACAAGUGCUAAGAGAGAAGUCAGAGGCUGUGGGAACAGAGAGGAGGAGUAUCUAACCAGCCUGGAGUAUCUGGAAGACUUCCUGAAGGAGGAGAAAACACCUGGGCUAAAUCUUAAAGGAAGACCAGAAGCUACCCAGGGAAAGAAGUGAAGGAAGGCAUUAUAAACAGAGAGGCCAGGAGAUUCCAGCCUCAGCAUUCCCAGAGAAGGCCCAGGAUCUCCCUGAGAGGCCCAGUUGGUGUUUGUGGAAUCAUCACUCCUCUGGUGAUCACGCAGUUUGCCUCACUUUCUCCAUGGAGCUCUUUGCUAAAGGACAUUCUCCUCCAGCUGUGAAGGAAAAGCCCAACAAAAGGCAGGGUACUUUGUUCUAACUGAGGAUGUCUACUGACACAGCCAAGCUGUAAAGCAGACCACGGACGGCAGUGCAGCGGGGAGAACAACUCUACAUCUGGUUGGAGGUGGAGUAAUGUCCAGUCUGGGCACAGAGAGAUGGCAGGUGUGCAGCUGCACUCAGCAUGGGAUAGAGCACCACCUGCCAGGCCAGAACAGAAAGAAGGGCGACGGAGACUGGCAGAGAAACAGCAAUUACUGCUCAGUGAGAAGUAAACAGCGUCUGCUUCCAGAGGCUUUACGGACCAGAAAGCCCACAGGAAAUAGCUCCUGCUUCCCAGCCUGGAGGUCCUCAUGCACUAGCCCUCCCUGCUACAAUUUUGAUGGUUUUUCGCAUAUUUACAGAAUUGUGCAACCAUCACCAUGAUCAGUCUUAGAAGAGUUAAUCACCCCUGACCCCAGAAAACUCUGUAUUCAUUAGCAGUCACUCCCUUUCCCCUUUCCACCCCUCUCCAACAUUAGGCAACCACUAAUCUACUCUCUGUCUCCAUAAACUGGUCUAUUUUGGACAUUUCACAUAAGCCUCCCUGGAUCCCAGUUUAAGCAUCCUGGGGUUUGUCUGCCUGCCAGAGCCAUGGUGCCACUGGGGCUACCUGUCCUGUGGGAUGACAAGGCAGGUCCAAACCUUUGCCUGCUCUCCCAUCCAUUCCUUUUGUGUUAGUCCAUGUGUCUCCCGACUGUUCUCUCCAACAACAACACAGACUGACAAAACCUACUGACUUGGAGUCAGGAACAGACUUUGCUAUUUUCUGGCUGUGUGAUCCUGAUGAGUCCCUUGAACCUCCUGGACUUGUUCCUCAGCCUAAAAACCAAGACUAAUAAAUCAAGUCUAUCUCACAGCCUUACGUGGGGAUCAAAAAACAUGGAGCAUGUGAACACACAUUGUACAUCACGAAGCUGUAUGCAAAUAAAUAUCGUGUAACUCCAGCCCUUUUUGAGUUUAUAAAUAAAAGUGAAAACCUCAUAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications