v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1273 (LINC01273) URS000075BD89_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01273: LINC01273 is a long non-coding RNA (lncRNA) that has been studied in relation to hepatocellular carcinoma (HCC) and sorafenib resistance [PMC8973700]. In a study, four short hairpin RNAs (shRNAs) were designed to target LINC01273, and it was found that sh-LINC01273#1 and sh-LINC01273#4 were effective in silencing LINC01273 [PMC8973700]. These shRNAs were then used in subsequent assays [PMC8973700]. The expression of LINC01273 was found to be high in both HCC tissues and sorafenib-resistant tissues [PMC8973700]. Furthermore, high expression of LINC01273 was associated with a poor prognosis [PMC8973700].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCAACCUUACCAGCCCCUCCAGCUUAGAGGUGGCAGUGGCUCUCUGCGGCUGCGAUUUCUUUCUCGGAGCGUCCUCCCCAUCCCGUUCGGCCUCUGCCUCCACCGUCGUCUCUGUAACCCGUUCCCUGUGGGAGAGUCUCUGUUGCGGUGUUCAGGGGUUUCGGUUUUCUGGCUGAACAGUGAUUAACGCGAGGGAAGGCGCUGACGGCAAGGUGGCAGGAAGAACAUUCCAACACAGACCACAACACCUAUGGACCUGGAAAACAUUGUGCUCAGUGAAAGAAGCCAGACACAGAAGGACAAUGUUGUAUGAGGGACACAUUCCAGCAAAAAGACACAAAGUGACAGAAUGGCUGCCUUUGAGUGGGGGUGAGAAGAGGUGGAUGGCAGGUACCAGAAGAGAAGGGAAUAAAUAUAUGAAGAAAUACAACCCCCUCGGGCAGUGCCUGGCACAGCAUAAAUGCCCAGGAAAAAGAGGCCCAGUUGCUUACGUUCCCGGCGACAGGGCCGGGACCAGCGCCGGCUUCCUGGUGAAGGAGGCCACCCUUUCCUCUUGAGGGGUCUGAGUAUGCAUGUCAGCACCCGGUGGGCACCCAGCACCCAGCUGACCAGGGGCCUUCACCUCUGUGGGGGUUACCGGCCUGGCCCUGAGAACUGGAUGAAAGCUGGAAUAAUUCUUUCUGUAAUAAAGCAAACGCAACCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications