Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3064 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3064 precursor URS000075BCCE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3064: MIR3064 is a microRNA that has been found to be down-regulated in BGC823 cell line infected by GML isolates compared to 26695 [PMC7485896]. It has also been shown to be involved in the tumorigenesis of colorectal cancer [PMC7485896]. In a study on heat stress in rats, MIR3064 was identified as one of the differentially expressed genes between the Control and H120 groups, suggesting its potential as a candidate marker for heat stress [PMC8871965]. The expression level of MIR3064 was found to be upregulated in response to heat stress [PMC8871965]. In the hippocampus of adult rats, MIR3064 was one of the 10 expressed miRNAs out of 438 currently annotated miRNAs [PMC5776139]. Additionally, MIR3064 was one of the four miRNAs that were silenced during grain development [PMC4048363]. These findings highlight the potential role and significance of MIR3064 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCUGGCUGUUGUGGUGUGCAAAACUCCGUACAUUGCUAUUUUGCCACACUGCAACACCUUACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

2D structure Publications