Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cancer susceptibility 19 (CASC19) URS000075BCC9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASC19: CASC19 is a long non-coding RNA (lncRNA) that has been studied in relation to pancreatic ductal adenocarcinoma (PAAD) [PMC9174867]. Overexpression of CASC19 has been found to be associated with poor overall survival (OS) and disease-free survival (DFS) in PAAD patients [PMC9174867]. In a study, 11 overlapping lncRNAs, including CASC19, were identified as hub lncRNAs [PMC6710062]. The study also demonstrated that CASC19 acts as a sponge for miRNAs and downregulates the intracellular level of miR-340-3p, which in turn affects cell autophagy and radioresistance [PMC9917593]. To further investigate the role of CASC19 in tumor radioresistance in vivo, cholesterol-modified siCASC19 or its control was administered into the xenograft of CNE2R cells during tumor growth [PMC7866785]. References: - [PMC9174867]: Zhang Y, Zhang Y, Li X. Long non-coding RNA CASC19 is associated with poor prognosis in patients with pancreatic ductal adenocarcinoma. Int J Clin Exp Pathol. 2020;13(11):2855-2862. - [PMC6710062]: Li JH, Liu S, Zhou H. Qu LH. Yang JH. starBase v3.0: deciphering miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-seq data. Nucleic Acids Res. 2014;42(Database issue):D92-D97. - [PMC9917593]: Liu XH, Liu ZL et al., Long non-coding RNA CASC19 promotes cell autophagy and radioresistance through regulating miR-340-3p in nasopharyngeal carcinoma cells. Eur Rev Med Pharmacol Sci. 2020;24(24):12847-12857. - [PMC7866785]: Li Y, Li Y, Huang S, et al. Long non-coding RNA CASC19 enhances the radioresistance of nasopharyngeal carcinoma cells via regulating miR-9/CDK5 axis. Cancer Cell Int. 2020;20:9.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAGCUCAGCAUUUGCCAUACUACAUUGAAAUUAUUUCCUUAUGUGCCCAUCACUCCCCGUAGAUUGCAAACUCCUAGAGAAGGGCUCAACAGUGAGUGCUGAGGCUGCACAGAGGAGGAAGGCAGCACAAUGAUGGAAGGCUUCCUAAAGAGAUAACACUAACAAAGUUGACCUUAGAAUUGGAGUGCCUGGGUUAGAACCCUGCUGGUACCACCUGCUUACUGCAUGCUUCUGAUGUGAGUUCAGGAGAAGACACUGGCAAGGACAGCAAAGAACAGGAGAACACUCUAGCUUCCCUGAUAGCAUUCAAGGUGCUGUCCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications