Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-424 precursor URS000075BC52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR424: MIR424 is a type of microRNA that has been studied in relation to tumours [PMC8007794]. In tumours larger than 5 cm, the expression of MIR424 was found to be significantly decreased [PMC8007794]. Additionally, the concentration of MIR424, which is the ortholog of rat miR322, was observed to decline shortly after the induction of vascular smooth muscle cell (vSMC) proliferation and then increase [PMC7123062]. These findings suggest that MIR424 may play a role in tumour development and vSMC proliferation [PMC8007794] [PMC7123062]. Further research is needed to fully understand the mechanisms and implications of MIR424 in these processes [PMC8007794] [PMC7123062].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications