Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-20b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-20b precursor URS000075BB8A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR20B: MIR20B is a microRNA that is found to have low expression in PC3 GSCs and U87MG GSCs, which are characterized by high glycolytic activity and expression of CD44 and ALDH1A3 mesenchymal markers [PMC7463503]. In TE3 esophageal cancer cells, transfection of MIR20B affected autophagy [PMC5302951]. Overexpression of the miR‐106a‐363 cluster, which includes MIR20B, exhibited an anti-proliferative effect on cancer cells [PMC8410538]. Upregulation of MIR20B reduced metastasis of 4T1 breast cancer cells to the lung, suggesting its role as a tumor suppressor miRNA [PMC7062679]. The rs13897515 polymorphism of the MIR20B gene has been associated with differences in Aβ1-42 levels in the cerebrospinal fluid [PMC9792503]. The ADNI database was queried for SNPs in or near the MIR20B gene on ChrXq26.2 [PMC9054681]. A miRNA peak downstream of MIR20B was highly represented in the testis [PMC3576234]. In a study predicting module genes, MIR106A, MIR106B, MIR20B, and MIR519D were identified as potential miRNAs [PMC9208509]. Individual assays also studied miR15b, MIR20B, miR122, miR-140-3p, miR-185, miR-192, miR-375, miR-483-5p and miR885-5P [PMC3956820]. In relation to Alzheimer's disease (AD), when the APOE ε4 allele was absent, higher levels of MIR20B were associated with reduced probability of AD and increased probability of normal cognitive function [PMC9054681].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUACCAAAGUGCUCAUAGUGCAGGUAGUUUUGGCAUGACUCUACUGUAGUAUGGGCACUUCCAGUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications