Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-770 precursor URS000075BA84_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR770: MIR770 is a microRNA that is involved in various biological processes and has been implicated in hepatocellular carcinoma and trophoblast invasion and apoptosis [PMC8450413] [PMC10145823]. In the hippocampus of adult rats, MIR770 is one of the 10 currently annotated miRNAs that are expressed [PMC5776139]. The knockout of Col5a1, a target gene of MIR770, has been shown to result in growth retardation and lethality, highlighting the importance of MIR770 in development [PMC5886287]. Additionally, MIR770 is expressed in the mouse eye at P60 [PMC4872275]. In terms of gene expression changes, MIR770 has been found to have one of the greatest fold changes among other genes [PMC4872275]. References: - [PMC8450413]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8450413/ - [PMC10145823]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10145823/ - [PMC5776139]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5776139/ - [PMC5886287]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5886287/ - [PMC4872275]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4872275/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAGCCACCUUCCGAGCCUCCAGUACCACGUGUCAGGGCCACAUGAGCUGGGCCUCGUGGGCCUGAUGUGGUGCUGGGGCCUCAGGGGUCUGCUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications