Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens let-7i stem-loop (hsa-let-7i) secondary structure diagram

Homo sapiens let-7i stem-loop (hsa-let-7i) URS000075B982_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7I: MIRLET7I is a microRNA that is downregulated in various diseases, including gastric cancer, ovarian cancer, sepsis, and HIV-1 infection [PMC9708458] [PMC6960189] [PMC8358855] [PMC6701281] [PMC4052096]. It is located in a CpG island and its expression can be regulated by epigenetic mechanisms [PMC9708458]. Two single nucleotide polymorphisms (SNPs), rs10877887 and rs13293512, are found in the promoter regions of MIRLET7I and the MIRLET7A1/MIRLET7F1/MIRLET7D cluster, respectively [PMC9708458]. Overexpression of MIRLET7I has been achieved using pCMV-MIR vectors in various cell lines [PMC6960189]. In sepsis patients, MIRLET7I expression is reduced compared to controls and has been proposed as a potential biomarker for sepsis diagnosis and prognosis [PMC8358855]. In ovarian cancer patients, MIRLET7I is significantly downregulated and can discriminate between benign and malignant ovarian disease [PMC6701281]. Bioinformatic analysis has shown that MIRLET7I targets genes related to cardiovascular development [PMC7912193]. In HIV-1 infection, dysregulation of MIRLET7I contributes to viral replication through DNA hypermethylation and immune system dysfunction. It also regulates the Vif/Vpr protein involved in immune response induction during the intermediate HIV infection stage. The high homology between MIRLET7I sequences and HIV-1 sequences supports its involvement in viral replication regulation during infection stages.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAUUGCCCGCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

2D structure Publications