v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) VIM antisense RNA 1 (VIM-AS1) URS000075B948_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

VIM-AS1: VIM-AS1 is a long non-coding RNA (lncRNA) that has been studied in various diseases, including diabetic retinopathy (DR) and prostate cancer. In DR, the effects of VIM-AS1 were found to be reversed by miR-655 inhibition [PMC8074428]. However, the expression levels of miR-29 and VIM-AS1 did not correlate in the plasma of DR patients, and over-expression of VIM-AS1 did not affect miR-29 levels [PMC9598326]. In prostate cancer, VIM-AS1 was shown to enhance HMGCS1 mRNA stability and promote cancer progression by binding with the IGF2BP2 protein [PMC9911078]. Additionally, deregulated expression of VIM-AS1 has been observed in type 2 diabetes mellitus and other diseases, suggesting its involvement in their pathogenesis [PMC8615960]. Furthermore, a recent study found that VIM-AS1 forms an R-loop within the VIM gene region [PMC6215836]. Overall, these findings highlight the diverse roles of VIM-AS1 in different diseases and provide insights into its molecular mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCUCCCGGAGGCGCAUGAUGUCCUCGGCCAGGUUGUCGCGCUCCACCUCGACGCGGGCUUUGUCGUUGGUUAGCUGGUCCACCUGCCGGCGCAGCUCCCGCAUCUCCUCCUCGUAGAGGUCCCCCAGGCGCGACUUGCCUUGGCCCUUGAGCUGCUCGAGCUCGGCCAGCAGGAUCUUAUUCUGCUGCUCCAGGAAGCGCACCUUGUCGAUGUAGUUGGCGAAGCGGUCAUUCAGCUCCUGCAGCUCCACCUUCUCGUUGGUGCGGGUGUUCUUGAACUCGGUGUUGAUGGCGUCGGCCAGCGAGAAGUCCACCGAGUCCUGCAGGAGCCGCACCCCGGGCACGCUGCUCCGCAGGCGCACGGCAGAGGAGCGCGUGGCAUACACGCCGCCCGGGGACGAGGCGUAGAGGCUGCGGCUGGUGCUGGGGCGCAGCGCGCUGCCCAGGCUGUAGGUGCGGGUGGACGUAGUCACGUAGCUCCGGCUGGAGCUCGGCCGGCUCGCGGUGCCCGGGCCGCCGAACAUCCUGCGGUAGGAGGACGAGGACACGGACCUGGUGGACAUGGCUGCGGAGGGUGGCGAUGGCCUGGGCGGCGGCGGUGGCGCGGACUGGCUCCCGGAGAAGAGGCGAACGAGGGCGCGACAGCAAAGCUCCCUUUGGAUGACAUAGAUUUAUUACUUAGUAGUAUAUUAUGUAUUGGCUGUCCCACAUUUUGAAAUUUAAUGGACUCGUGGUGAUCAGAAUAAAAGAAGCCUUCGAUGUGAGGCCCAGGCAUUGAGUACCAUGUGUGCGAUUCACAAGCCUUGGCAUCUGAACAAUUUUUUGGAAGGAUCCAUCAGGACAACACGUCGGGGGUGUACUAGUGAAGUGAUUUUCCAAAUGUGCUACUCAGACCUGUAGCAUCAGCAUCACCGGAUAAUUUGUUAGAAAUUCCAACUGUUAGGCCCCACUUUAGACCAACUGAAUGUGAAACUCUGGGAGUACGUGGGGCCCAGCAAUUUGUGUUUUUACAAGACUUACCAGGUGAUUCUGAGAACCACUGUGCUAGUGAAUUGUUCCUGUCUGUGGCCACGUAGAAUAAGAAAACCAUAGGGUUGGAAAAUGGGGAAACUGGUGAGUGUUCGCUUAUGAGGAAAUGAAGAAUAGAUAGAAAAGAAUUAGUUAACUUUUGGAAUUCAAAAGAGAAGCAGUUUGUAAAAGCCAGGAAUUUGAUUUGAAGGACUAAUUGCUUGCAGAAUCUUUGCUUUCUCAGAGAGGGGCAAUCCAGAUCACUAGGUUACCGUGAAAUAUGUUGGUAUGGCUCUAAAAUUCUAGAAUAAUCUCUCUAGUGAGAAAAGGCAUACCUUUCCAUAUUAGGACAAAACUUCAAAUCAGGUUUGUAAAAUCCUAUAAGAUUAUUGUAUCCCAUUGCCAUGGCCAACUUGUUUGUCUCUGGAGAUCCCAGUUUCUACAUCUGAAAACCAUAUGCAUUCCUGCUCACCAGGAAUUAUCUCGCUGAAUGAAGCAAGAGAUUCAGGAUGUGUAAGAGAAUUUAUGAAGCAUUUGGAUUACCAAGAAAUGUGAAGUAUAAAGAUCAAGAAUGAUUAUUACAAACACUGAUGGUAAAGAGGUGUUUCGAAGUCGAUGCAAAAAAUGAGUUGCUUAUUUCAGUCUCUCUUUGAUAUAUCUGCCUUUUUAGUGCUGACUCUAUCAUGUAUUCACUAUUUGAUUUUCAGUGAAUCACAUUUUUUAAAGCUUUUAAUCUGUUUCCUCAAAAAAUAUAUUUUUUAAAAAUAUUUACUCAGGAUUGUUGUGAGAAUAAAAUUGAUUCGAUUGAUAUUUCAAAAAAGAAAUAUAUUUUUAAAAAAUAAAGCAAUACCAUUUUUGGAUAUGCUAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications