Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CACNA1C intronic transcript 3 (CACNA1C-IT3) URS000075B8B9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CACNA1C-IT3: CACNA1C-IT3 is a long non-coding RNA (lncRNA) that has been found to be specific to testis tissue, suggesting its potential role in the male reproductive system [PMC8231607]. It is one of the nine lncRNAs (GRM7-AS3, ARHGAP26-AS1, BSN-AS1, KRBOX1-AS1, CACNA1C-IT3, AC012361.1, FGF14-IT1, AC012494.1, and GS1-24F4.2) that showed testis-specific expression [PMC8231607]. CACNA1C-IT3 interacts with miR-204-5p [PMC8231607]. The expression of CACNA1C-IT3 and other lncRNAs and miRNAs could potentially be used for diagnostic applications in male infertility after SARS-CoV2 infection [PMC8231607]. In addition to its role in male reproductive system disorders, CACNA1C-IT3 has also been implicated in other diseases. It was found to be downregulated in FHL1 knockdown cells and associated with calcium channel-related transcripts [PMC6534093]. Furthermore, CACNA1C-IT3 was identified as one of the 15 exosome-related lncRNAs that could serve as a prognostic signature for assessing the overall survival of breast cancer patients [PMC9789946]. In the context of acute lymphoblastic leukemia (ALL), CACNA1C-IT3 was among the significantly upregulated lncRNAs in bone marrow samples from patients with ALL [PMC8290159]. The differential expression of CACNAIC-T3 and other lncRNAs could potentially serve as diagnostic and therapeutic targets for ALL [PMC8290159].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGGGCUAAACUUAGAGGGAAGCUGUCAUCACCCUAGGGCCUGAGGAGGAAGGGGAGAAAAUACUGUUUGGGGGGCCUGGUGGGAGCUGUAGCUGGGAGGAGGACCAUGAGGGAGAAACCAUAGUCAUGGAAGGAUGUUGUCACUGCCAGGACCAAGACACCAAGACUGUGUGCUAGGCACUGAGUUAGAGUUGAAGACCCUCAAGAAUUCCACUGACAACUGAAUCAUCAAAGGGAACCGAGCCCUGCCCAAGGACAUACAGUUGUUUUCCUCUUCCUUGUCCUUUGGAGAAGCACAGCUGAAGCUUCCUGCCCACACCCCAGCCCCUCCUCCUUGAGCAUGAAUGUGCAGACCACCCACCGCCCCAUGCUUGUAUCUACAACAGCUAUGAGGAAGAACAUACAGAUUAAUCACCCUGCUGCGGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications