Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-4451 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-4451 precursor URS000075B8AC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4451: MIR4451 is a microRNA that is induced by atRA exposure and is associated with nutrient metabolism [PMC4168020] [PMC6138641]. It has been found to be up-regulated in differently developed seeds of AK58 and in superior and inferior seeds of different developmental stages [PMC6138641]. The expression levels of MIR4451 were decreased from 28 DAF to 42 DAF in SGP [PMC6138641]. MIR4451 targets CM 17, which may modulate nutrient storage in cereal seeds [PMC6138641]. The expression levels of MIR4451 were found to be up-regulated from 7 DAF to 21 DAF, with a peak at 21 DAF in SGP [PMC6138641]. The targets containing TC425315 (ARF), TC416811 (NAC), TC426980 (Hox9), TC386518 (VPE1), TC369161 (TFIID), TC370181 (TacaM2), CA733841 (CM17), TC409188 (PRKL), TC415749 (Resistance protein), TC381152, TC432124, and TC385289 showed converse expression profiles when compared with the expression levels of MIR4451 during the same grain-filling periods of superior and inferior grains [PMC6138641].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGUACCUCAGCUUUGCUCCCAACCAACCACUUCCACAUGUUUUGCUGGUAGAGCUGAGGACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications