Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1256 precursor URS000075B8A9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1256: MIR1256 is a microRNA that has been implicated in various types of cancer, including breast cancer, bladder tumors, and prostate cancer [PMC9775590]. In a study validating miRNA expression in ameloblastoma tumors, MIR1256 was found to be inconsistently expressed compared to non-ameloblastoma controls [PMC5354851]. Additionally, MIR1256 was found to bind to circHECTD1 and participate in the Ago2 complex [PMC7216265]. In another study, gains covering MIR1256 were observed in a patient with prostate cancer [PMC9775590]. Interestingly, the alteration of MIR1256 was associated with a hazard ratio of less than 1 [PMC8108987]. Furthermore, miR1299 and miR548X were also found to be overexpressed in ameloblastomas [PMC7920560]. Overall, MIR1256 is a microRNA that has been implicated in various types of cancer and has been found to be inconsistently expressed in ameloblastoma tumors. It also plays a role in circHECTD1 binding and participates in the Ago2 complex. Additionally, gains covering MIR1256 have been observed in prostate cancer patients. The alteration of MIR1256 is associated with a hazard ratio of less than 1. Furthermore, miR1299 and miR548X have also been found to be overexpressed in ameloblastomas.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUCAGCCUGUUGAAGCUUUGAAGCUUUGAUGCCAGGCAUUGACUUCUCACUAGCUGUGAAAGUCCUAGCUAAAGAGAAGUCAAUGCAUGACAUCUUGUUUCAAUAGAUGGCUGUUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications