v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) wound and keratinocyte migration associated lncRNA 2 (WAKMAR2) URS000075B835_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

WAKMAR2: WAKMAR2 is a gene that has been studied in various contexts [PMC8319425]. According to a correlation analysis, patients with lower WAKMAR2 expression may have a poor response to immune checkpoint inhibitors (ICIs) [PMC8319425]. In a study, it was found that overexpression of WAKMAR2 led to a decrease in the level of miR-4478, while it had no impact on the expression of miR-6068 and miR-6132 [PMC7921149]. This suggests that WAKMAR2 may have specific effects on certain microRNAs [PMC7921149]. Additionally, increased expression of WAKMAR2 and EGOT may promote viral replication in SARS-CoV-2-infected cells [PMC7999169]. This indicates that WAKMAR2 could potentially play a role in viral infections [PMC7999169]. Furthermore, it has been shown that WAKMAR2 is an important regulator in the healing of skin wounds and its deficiency may contribute to the pathogenesis of chronic wounds [PMC7921149]. This suggests that WAKMAR2 could be involved in wound healing processes [PMC7921149]. Overall, these findings highlight the potential significance of WAKMAR2 in various biological processes and its potential implications for disease outcomes [PMC8319425, PMC7921149, PMC7999169].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUGCUUUUCUGAGAGGCCAGGUGGCAGGAUGUGGGACGACUCCAGCUGACAAAGACAGUCUAACCGUGGGGUAGGGGCUGGAGCAGGGGCCAGCGACCCACGUCUACAUGCAUACUUCUCUUACACUGCUGCUACUGGAAAAGCUGAACCCCGCGCCAGGACCCCAGCCCCCUGCAAGGACCCGUGAGCGUCUGGGAAGCUGUCUCUGGGACUGAAGCCCCCCACCUCCGCCGGGCUGGCGGCCACUGCGGUACCCUACGCCCCGUCGGGCUGGUCCUGCACAAUUUGGGAAAAAGCCGCAGCGCUUCUGCAAGGUCUACGUGGCCAUGAGCAUGCAACGCUUGGCUCCAAAAAAGACACGAAAGGAGCAAAGCGCCAACGACCACCCGAUCGGAGGGCCCGAGGGGCGCCUCUUCACCAGUCAGCUGCAGCUUAAGUUCCGUGCAUUAUCUGAAAGGAACAGCUGGCUGGAGGUAUCCAGGGCUGUCACUCCAACCUCUGCAGCAGUGACCUCAACUCCCAGCACUUCAAAACCCAGACAGAAACGUCCAACAAACUCCCAGUCCAGGAGCGCUGCAAAACCAACGCCAGUUGUUUUUCUGCAGAAAAUCAUCAACUGUGGAGAAGAAGAAGGGAAAUAAGAAAGAAAGAAAACCCUAAAAACCACCCUGGCGCCCGGGCCCGCAGGCCUCGGGCCGGCUCUGAAAAGUUUGGGCUGUGCACGUGAUGAGCGCGUAGGCGGGAGCCCCAGACAGGACCCGGGCGGGCAUUUCGAGAAAAAGCAGCGGUGACAGCCUUUGGUCCCCAUCUCCAUUGUUCCUGCCAGCUCUGGACCCCAGGCUGCAUGAGACGUAGGUCCCAGGGGACACCCGACCCCGUGGCCCCAGUCUUAGCUUCCACUGCCCCUAUCUGGCUCAUGUCUUGCUGUCUGGUGUCAUGAACUGGGAGUGCAGUAAAGAGGAGUGACAAGCCUGAGGGGCCACGUUCAUACCUGCCACUGCCAACUGUCCUGAUGUAACUGCUUUGUCAUCUUGCCUGCCAGGAUUUGUGACAAGGGCAAGAAUCUUCUGUUCCAUAUGCAACAUCUUCUGGCAGCCUUGUCCUUUUUCUGUCCUUGACGACUACAAUAACAAACAGCUGUUGCCGAGGCAUUGCUGUUGACGUGUUACCUUUGAAACCUCCCUCCUGUUAUGGAAUAAGCCUCUUCCAGAUCAUGGCUCAUUAUCAUCUAGUCUGACAAGCAGCCUUGUUGCCACGGAGACCCAAAGGGAUCAGGCGUGGCAUUUGCCUGCAUCAUCACCCCCUCCAGGGGAACUAUAAGGACUCUUCUGUGCGUCAUGCGUGGCUGUCCUGGGACUGGCUGCCACCAGACUUUUCCUGCGGGUAAAACCUAAACAAAUGAUCAGCUGCAGAUAAUAUCAAGACCUCUGUUUGAUAUGUUAAUAGUGACAGCCAGAUUUCCACAAUUAACAACGAGGUGGGAAGAAAACACUGUAGUCACCAGACUUGGGAGGAGAGGGUUUGUAUUCACAUAAACACAACCUCACGUCACUGCUUGCCACCACAAAGGGCUCUGUUCACUGUUUUGUUCUCAAAGAUCAUCCUUGCGCUCAUCCUCUGAUCUUGAAUUUCUACAUAACUUUCUCAGUUUAUAUGCCCUGUGGCAAGUGCAGCAAGCACUGUUUCCUGUUUCUAAACUUGUAGAAAAUCAUCCAUACAUCUUACAGUUGUCAGUUUUAACCAGAUAACAGUGGCACUUUGUUGCUGCUUUUUUAUCUUUAGCUUAGGUUAACAGGACCCUGGAAGUAAAGUUGUUGAUUUAUUCAAUAGAGUAUUCUCAAUUAAUUUGGCUAGAUUUCUACAUGAUUCAAAAUCUAAAAAAGUAGAAAUGCAUGCUUACAUGUCUAAGGCCUGAAAAAUUGGUAGUGACAUCCCAAAAUAAAUGAAGGUUUUAAAACAAUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications