v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RTCA antisense RNA 1 (RTCA-AS1) URS000075B7F8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RTCA-AS1: RTCA-AS1 is a long non-coding RNA (lncRNA) that has been incorporated into a Cox model along with eight other lncRNAs in a study [PMC7681235]. The study used specific primer sequences for RTCA-AS1 in their experiments [PMC7681235]. RTCA-AS1 was found to be positively correlated with chromatin-modifying protein 4 (CHMP4)A [PMC7681235]. The study also found that AC099850.3, AL512274.1, and RTCA-AS1 were significantly associated with the pathological grade, and RTCA-AS1 was significantly associated with T stage [PMC7681235]. Some of the lncRNAs, including PTCSC2, LINC01963, AP002884.1, RTCA-AS1, AL512274.1, and AL354733.3 have not been extensively studied [PMC7681235]. The expression levels of AL512274.1, PTCSC2, LINC01963, RTCA-AS1, AL354733.3 and MIR600HG were lower in high-risk patients compared to low-risk patients [PMC7681235]. In a bioinformatics analysis of oral squamous cell carcinoma (OSCC), several autophagy-related lncRNAs including AL354733.3 and RTCA-AS1 were predicted to have prognostic values in OSCC and were validated through experiments using clinical samples [PMC9574005]. References: [PMC7681235] Liang T et al., "Identification of autophagy-related long non-coding RNA prognostic signature for oral squamous cell carcinoma." J Cell Mol Med., 2020 Dec;24(24):14442-14453. [PMC9574005] Liang T et al., "Identification of autophagy-related long non-coding RNA prognostic signature for oral squamous cell carcinoma." J Cell Mol Med., 2021 Mar;25(6):2851-2864.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUCAGUGCGCAUGCGCGUAGCUCGGCUUAAAGGAGCCGCGCUGGGAACACUGCGGUCGGGGCGAGGAAGCUGCCGGGGAAGUGAGAUGACGGUCGCGGGGGUGCCCAGGAGCCCUGAAAAACUUGUGCCCUGGGCACGGCAAAAUCUGCAGGUUGCAGAAAGUCUCAACUGAUCCUGGCAUACCCCGAGGUGCCGACUUUUAGAGCUGAAGAUGCAAGAAAGAUUGGGAUCCUGCGAUGCACCGAACCUGUCUCUCGAAGUGUGUGCGCCCUGCUUCCUGUGUUAAACAAUUUGCUACAAGGUCACACAAUUUUAACUAGAAGACUGAGAUGUGAACCUGGGUGGUCUGAUGUGAACACCACUGUCUGGUAAUCCCAACGCUCUGCUGCUUUGCGACAGAGAAUGUUUUAGGGAACACACAGACUAUGUACUUAACCAAAUCUGGAAUUUGCCGUAAGAUAUUAAUCAGAGAAGUAAUGAUACUUGCAUUUUAAAAUGAAGGCUUUGGCAGUAGGAGAAGGGUGAAUAAGAGGCUUAAGAGCCUGAAGGGAGAAAUGCCAAUGAUACAAUUAUCCAGCAAGAAAUAAUCAGAAGUUGAAGUAAGGCAAUGAUGGUAGGGAUGGAAUAUAAAAAAGCUGUACCCCUAUCUGACAUCUUUAUUGGGGGAACCCGCCCCCAAUAUUUCAACGUAGGUUCUUUCUAUUUUCCAUAAGUGUUGGCCAGCUGAGAAAUAAAGAGAGACAGUAUAAAGAGAGGAAUUUUACAGCUGAGCCACCGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications