Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1306 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1306 precursor URS000075B769_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1306: MIR1306 is a miRNA that has been found to be expressed in the brain, and it is conserved in mice [PMC4487986]. After IFN-γ stimulation, MIR1306 is one of the top 10 miRNAs that are upregulated [PMC8010072]. MIR1306 is highly expressed in reproductive organs, including the uterus and vagina, suggesting a potential role in abnormal pregnancy outcomes [PMC8645989]. It has been shown to inhibit the production of proinflammatory cytokines such as NF-κB and IL-1β [PMC8155903]. MIR1306 affects downstream cytokine expression by targeting key genes in the TLR4 pathway [PMC8155903]. The MIR1306 gene overlaps with the DGCR8 coding region and is conserved in primates [PMC7357559]. In studies based on the GSE94462 dataset, MIR1306 was among several miRNAs identified [PMC9922242]. It has also been reported as one of the most frequently affected miRNA genes in CAKUT CNVs, supporting its potential role in CAKUT [PMC9587983]. Among six identified miRNAs, only miR1226 showed statistically significant differences compared to controls [PMC6764711].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGCAGUCUCCACCACCUCCCCUGCAAACGUCCAGUGGUGCAGAGGUAAUGGACGUUGGCUCUGGUGGUGAUGGACAGUCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

2D structure Publications