Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-548n precursor URS000075B760_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR548N: MIR548N is a microRNA that has been found to exhibit vulnerability to mutation in certain regions of the genome [PMC6756205]. Somatic deletions of approximately 500 bp in chromosome 2, specifically in the PRKRA and MIR548N genes, have been detected in samples from patients with schizophrenia [PMC6756205]. In a study investigating genetic variants associated with uncertain significance, one variant was found to affect the region harboring MIR548N [PMC6375196]. MIR548N is part of a specific grouping of microRNAs that have not previously been associated with preterm birth, and there is limited information about their function in disease processes [PMC5429750]. In terms of genetic expression, there have been higher levels of miR548a, miR548aa, miR548ai, miR548ak, and MIR548N observed in term pregnancies compared to preterm births [PMC5429750]. The region containing MIR548N has also been associated with a variant within the PRKRA gene and a noncoding transcript [PMC4289690]. Additionally, MIR548N has been identified as one of several brain-enriched microRNA-coding long noncoding RNAs [PMC4468152]. The somatic deletion affecting PRKRA and MIR548N was found only in DNA from the prefrontal cortex and not in DNA from other tissues [PMC3897957].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUGGUGCAAAAGUAAUUGUGGAUUUUGUCGUUAAAAAUAGCAAAACCCGCAAUUACUUUUGCACCAACCUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 548n (ENSGGOG00000039476.1)
Publications