v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-429 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-429 precursor URS000075B715_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR429: MIR429 is a microRNA that has been previously reported along with MIR200A, MIR200B, MIR200C, and MIR25 [PMC6701281]. It has been found to regulate the proliferation and invasion of endometrial, prostate, and breast carcinoma [PMC9866967].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGCCGGCCGAUGGGCGUCUUACCAGACAUGGUUAGACCUGGCCCUCUGUCUAAUACUGUCUGGUAAAACCGUCCAUCCGCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications