Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-339 precursor URS000075B703_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR339: MIR339 is a microRNA that has been studied in various contexts. It has been found that ZMYND8-binding peaks at enhancer regions related to MIR339, Lrrc28, and Lipa were diminished [PMC8586003]. MIR339 is one of the differentially expressed pri-miRNAs in HUVECs and HAECs [PMC8216629]. It has also been identified as a graft-transmissible miRNA in potatoes [PMC10067726]. In the context of ovarian tumors, an increase in the methylation level of MIR339 was associated with metastatic primary ovarian tumors and the onset of OvCa pathogenesis [PMC8835734]. In another study, MIR339 was found to be upregulated after IFN-γ stimulation [PMC8010072]. Additionally, MIR339 was validated as a miRNA in different contexts such as multiple sclerosis and pancreatic ductal adenocarcinoma (PDAC) [PMC6006352] [PMC9599289]. It has also been reported that MIR339 is involved in regulating sucrose degradation and sucrose synthase production at a transcription level [PMC3997385]. Overall, these studies highlight the diverse roles of MIR339 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGCGGCCGCUCUCCCUGUCCUCCAGGAGCUCACGUGUGCCUGCCUGUGAGCGCCUCGACGACAGAGCCGGCGCCUGCCCCAGUGUCUGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications