Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4432 URS000075B6CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4432: Hsa-mir-4432 is a microRNA that was mentioned in the provided text [PMC8127061]. The expression of hsa-mir-4432 remained constant in CAOV3-HE4-L cells but increased in CAOV3-A2-L cells, although not significantly [PMC8127061]. Hsa-mir-4432 was one of the miRNAs that were intersected by three out of four websites, along with hsa-miR-129-5p, hsa-miR-4282, hsa-miR-4778-5p, and hsa-miR-4708-3p [PMC8127061]. Hsa-mir-4432 and hsa-miR-7 were predicted to target the PACE4 rs4965833 polymorphism [PMC7197988]. However, due to limited studies on hsa-mir-4432, further research focused on hsa-miR7 instead [PMC7197988]. In a study using IPA analysis, it was found that miRNAs targeting PTS (hsa-mir4432) were downregulated and predicted to regulate dopamine receptor signaling and degradation [PMC9781133].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGACUCUGCAAGAUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications