Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-211 precursor URS000075B6A0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR211: MIR211 is a cellular miRNA that has been found to be upregulated in various types of tumors, particularly in gliomas. Conversely, the downregulation of MIR211 can increase the sensitivity of glioma cells to temozolomide (TMZ) [PMC7732422]. In a study, it was observed that both MIR211 overexpression and EZRIN siRNA transfection led to an increase in the percentage of cells in the G0/G1 phase and a decrease in the percentage of cells in the S phase in human osteosarcoma cells [PMC6617937]. This suggests that MIR211 may play a role in cell cycle regulation. Additionally, MIR211 was selected as one of five cellular miRNAs for further investigation due to its potential complementary target sequence in the HIV-1 genome [PMC3256098]. The HIV-1 Nef gene is known to be dispensable for viral replication in cultured human cells [PMC3256098]. Overall, these findings highlight the potential significance of MIR211 as a regulator of cell cycle progression and its potential role in HIV-1 infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUCGCCUAGGGCUCUGAGCAGGGCAGGGACAGCAAAGGGGUGCUCAGUUGUCACUUCCCACAGCACGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications