Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-182 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-182 precursor URS000075B66E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR182: MIR182 is a microRNA that has been implicated in various types of cancer. It is frequently upregulated in human breast tumor tissues, cell lines, and serum of breast cancer patients compared to healthy controls [PMC5308578]. Similarly, upregulated expression of MIR182 has been observed in lung cancer cells and tissues [PMC5308578]. MIR182 has also been found to be upregulated in clinical tissue samples of melanoma, glioma tumors, ovarian cancer, colorectal cancer, and prostate cancer [PMC5308578]. In these cancers, MIR182 promotes survival, migration, invasion, and metastasis of tumor cells [PMC5308578]. The deregulation of MIR182 in human cancers can be attributed to several possible causes [PMC5308578]. In the context of oral squamous cell carcinoma (OSCC), overexpression of MIR182 has been shown to inhibit apoptosis of OSCC cells [PMC5308578]. Conversely, inhibition of MIR182 enhances apoptosis in OSCC cells [PMC5308578]. The mechanism by which MIR182 functions as an oncogene in OSCC involves the regulation of RASA1 and SPRED1 and leads to constitutive Ras activation [PMC5308578]. Overall, the evidence suggests that MIR182 plays a significant role as an oncogene in various types of cancers by promoting tumor cell survival and metastasis. It is frequently upregulated in different types of tumors and can inhibit apoptosis. The deregulation of MIR182 can be attributed to various causes. In OSCC specifically, it regulates RASA1 and SPRED1 leading to constitutive Ras activation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGCUGCUUGCCUCCCCCCGUUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAACAGGAUCCGGUGGUUCUAGACUUGCCAACUAUGGGGCGAGGACUCAGCCGGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications