Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4311 precursor URS000075B632_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4311: Hsa-mir-4311 is a microRNA that has been studied in relation to various biological processes and diseases. It has been found to interact with several other microRNAs, including hsa-miR-3163, hsa-miR-3065-5p, hsa-miR-551b-5p, and hsa-miR-875-3p [PMC6005163]. In silico analysis has identified nine miRNAs, including hsa-mir-4311, that may have common target genes [PMC7407898]. Hsa-mir-4311 has been linked with downstream genes such as ZYX, PRKAR1A, BTAF1, LRP3, and ETS1 [PMC7050132]. It is also associated with single nucleotide polymorphisms (SNPs) that may affect its function and regulation of mRNA production and stability [PMC4134282]. Hsa-mir-4311 has been found to interact with LINC00472 in a ceRNA manner [PMC8974029]. The binding between hsa-mir-4311 and LINC00472 has been confirmed through dual-luciferase assays [PMC8974029]. Hsa-mir-4311 may also regulate the expression of GNG7 as its downstream protein effector [PMC8974029]. The expression of hsa-mir-4311 is significantly increased in human oral squamous cell carcinoma (OSCC) cells compared to normal human oral keratinocytes [PMC8974029]. References: [PMC6005163] [PMC8902122] [PMC7407898] [PMC7050132] [PMC4134282] [PMC4671954] [PMCID: PMC8974029]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGAGAGGGGAAAGAGAGCUGAGUGUGACCUGGAGCAGCUCAGGAGGGCUUCCUGGGUGAGGUGGCAGGUUACAGGUUCGAUCUUUGGCCCUCAGAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications