Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-656 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-656 precursor URS000075B5E4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR656: MIR656 is a microRNA that has been implicated in various biological processes and diseases. It has been found to be associated with sensitivity to KIN001-236 in ovarian cell lines and bleomycin in renal cell carcinoma cell lines [PMC9716673]. Additionally, MIR656 has been identified as a potential gene associated with the progression of severe pneumonia [PMC6090384]. It is worth noting that MIR656, along with EIF5AP4, are novel genes that have not yet been reported to be related to pneumonia [PMC6090384]. MIR656 has also been identified as a gene that shows a significantly lower methylation rate in invasive adenocarcinoma relative to AIS [PMC6422190]. In the context of multiple sclerosis, MIR656 is one of the miRNAs that seem to be less expressed in the diseased context [PMC4655260]. Furthermore, MIR656 has shown decreased expression levels in certain brain regions compared to others [PMC7848201]. Overall, these findings suggest that MIR656 may play important roles in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAAAUAGGUUGCCUGUGAGGUGUUCACUUUCUAUAUGAUGAAUAUUAUACAGUCAACCUCUUUCCGAUAUCGAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications