Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3934-3p URS000075B5A4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3934: Hsa-mir-3934 is a microRNA that has been found to be correlated with survival rate and disease development in patients with non-small cell lung cancer (NSCLC) [PMC6676217]. It is one of the miRNAs that were not previously detected to be differentially expressed during control myogenesis [PMC4186784]. While 26 miRNAs were already reported to be involved in muscle differentiation, hsa-mir-3934 was not previously known to be involved in this process [PMC4186784]. In a study on cardiac marker genes during hypertrophy and other cardiac diseases, hsa-mir-3934 was identified as one of the miRNAs that may play an essential role in regulating these genes [PMC3842578]. The secondary structure analysis showed that hsa-mir-3934 has a strong binding affinity with the 3′UTR of the BTD gene [PMC8846296]. In breast cancer, hsa-mir-3934 was one of the seven miRNAs included in an optimized prognostic gene signature and a MiR Score prognostic model, which showed a high forecast ability for breast cancer prognosis [PMC7236498]. Furthermore, hsa-mir-1911, hsa-mir-3934, and hsa-mir-526b were found to potentially target UNC5C, a member of the UNC-5 family of netrin receptors [PMC7236498]. However, further studies are needed to confirm this association in breast cancer patients [PMC7236498]. Additionally, hsa-mir-3934 was identified as one of the differentially expressed miRNAs in smoking-associated lung cancer using TCGA LUAD dataset analysis [PMC6257755]. References: [PMC6676217] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6676217/ [PMC4186784] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4186784/ [PMC3842578] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3842578/ [PMC8846296] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8846296/ [PMC7236498] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7236498/ [PMC6257755] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6257755/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCAGGUUGCACAGCUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications