v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA complex group 26 (HCG26) URS000075B50E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HCG26: HCG26 is a long non-coding RNA (lncRNA) that has been studied in the context of ovarian folliculogenesis. The genotyping of the 298bp HCG26 AluY insertion was performed by amplifying the surrounding region using primers flanking the insertion site [PMC6380582]. Functional lncRNAs, including HCG26, have been found to play a role in regulating follicle development and regeneration during ovarian folliculogenesis [PMC8762113]. Other lncRNAs involved in this process include growth arrest specific 5 (GAS5), lncRNA Neat1, and lncRNA MALAT1 [Li et al., 2018a]. These lncRNAs exert their regulatory effects through diverse mechanisms [PMC8762113]. In conclusion, HCG26 is a long non-coding RNA that has been studied in the context of ovarian folliculogenesis. The genotyping of its AluY insertion was performed using specific primers [PMC6380582]. Functional lncRNAs, including HCG26, GAS5, Neat1, and MALAT1, have been found to regulate follicle development and regeneration through diverse mechanisms [Li et al., 2018a] [PMC8762113].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUUCCCUUUUGCCAUGUAAUGCAACCUACUCGUGGGUGCCCAGGAUUGAGAUUGGACGUCUUUGGGAACCAUUACUCGGCCCAUCACAUCUGAGUAUGUUGAAGUCACCGAGGAUCAAGGAGACAGCACUGCUGGAGAGGGCGAUAGUGAACCAGGAACUACAAGAGUCAGGACUGAGAGGAACGGCCUGGGGCCCACAGGGAAUGGCUGCAAUGAGGGGAGUGGGGCCUGAAUCUGAUGACAGCUUUGGGGGCUUAGGAAGGAAGGAGGCAGAAAGGUCUGAGAACCACAGUGAGGAGUGAGGAUGCCACCCCACCUCUGGGCCAAGGGUACAAGGUCCCUGUGCAAACUCCCCCAUGUGGGAGGACUUUGGAAGGGACCACAUCCUCUGGCAGACACAGACAUCGCUGGAGCUGUGAGGUCCAGGAACAUCCUGAGACAGGAUGUGGAGGUUUUGCUGAUCAUGGGCUGAGAAUUCCAAGGGGCACAGCGGGAAGACUUCUGGAUUUGGGAAUGGGGUAUGGGGAGACAAAAUAGGGGUGUGCAGAGCCUUGUGGGGAUGUGAAUGCAGGGUGUUUGGGGGACCCAGUGUGACUGACACAAACAGGGAAAAGGCAUGAUGAGCUCAGUCCUGGUGGACUCAAGGCAGAUGAUGGUGCUGAGGCUGUGGGAGACGAGGGAGGAGGCUCAGGGGUGGCUUUCACCUGGGCUCUGUCCAUGGAGGUGAGGACAGGGAGAUAGUUGGGCCUCAGUGCUGUGUGGACCCUUUCUUGUCUCCCUGAUGACUGGAUGGAGGGCCUGGAGGAAGAGGGGUCUUAGAGGAUUCACUCAUGUCCCUGGGGGAGGGGGACUCACUCCAGGUCUCAGGUCUGCACUGACACAUUUGUUUGUGGCUUGGGGCUGCCUGCUAUAAACUAUUGGGGGUUCGUCCAUUUUGGAGUUAUAACCUAAGGCAGAAACUCAGAUGGUUCAAAUGUCCUCUUCAUGAAGCAAUGUUAUCAGCGUAUCAUUUAGAUUGUCUUGCAAGAGUCUCAUUUGUUGUUUUUCUAAAUGCCUGCCAAUAUUGUUUGAAAAUCUACAAAUGUGAUAAAUGUAUCUUCAAAGUUAACUGGUUGCAGGUUGUUUAACCUUAUAUGUACAGUUUCACAUAUGUAUAAAAACAGUAGUUUGGGCCUCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications