Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-654 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-654 precursor URS000075B509_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR654: MIR654 is a microRNA that has been found to be associated with various biological processes, including carcinogenesis [PMC9224266]. In ovarian cancer cells, the long non-coding RNA EMX2OS can directly bind to MIR654 and inhibit its expression, resulting in the upregulation of PD-L1 and the promotion of proliferation, invasion, and spheroid formation [PMC8974003]. However, MIR654 was not detected in head and neck cancers [PMC5354851]. Several studies have shown that MIR654 can inhibit the replication or propagation of influenza virus [PMC3774802]. Additionally, MIR654 has been found to bind to PB1 in MDCK cells and inhibit the replication of H1N1 virus [PMC5360757]. In a study on prognosis, 10 miRNAs were found to be associated with a good prognosis [PMC9924325]. Furthermore, four long non-coding RNAs (lncRNAs) and three miRNAs were found to regulate AZGP1 [PMC9924325]. Overall, MIR654 is a microRNA that plays a role in various biological processes including carcinogenesis. It can be regulated by long non-coding RNAs and has been shown to have inhibitory effects on influenza virus replication. However, its expression may vary depending on the type of cancer or infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUAAGUGGAAAGAUGGUGGGCCGCAGAACAUGUGCUGAGUUCGUGCCAUAUGUCUGCUGACCAUCACCUUUAGAAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

2D structure Publications