v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HLA complex group 23 (HCG23) URS000075B48F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HCG23: HCG23 (HLA complex group 23) is a gene located at 6p21.32, within the HLA locus, and is associated with immune-related diseases [PMC7156602]. HCG23 has been found to be significantly differentially expressed in lung adenocarcinoma patients compared to normal individuals [PMC7156602]. It has also been implicated in adenocarcinoma of the lung and is closely associated with five transcription factors (DDX17, STAT1, PPARG, ETS1, and E2F6) [PMC7156602]. Structural changes in HCG23 due to single nucleotide mutations can affect protein binding and have been shown to be associated with adenocarcinoma of the lung [PMC7156602]. HCG23 is part of a haplotype block that includes several single nucleotide polymorphisms (SNPs) mapped onto different transcripts of HCG23 [PMC7156602]. Additionally, HCG23 is located near other genes such as BTNL2 and HLA-DRA within a cluster of SNPs associated with immune-related diseases [PMC8192578] [PMC4099326]. Overall, HCG23 plays a significant role in immune-related diseases and has implications in lung adenocarcinoma.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCACCAACCCCUCUCCUUCCUGUGGCUUUUCUAACUGGAACUGGAACUCAGAAAGUACAUUAAUCACCAAUUUGGGAAGCUAUAGGAAAGUAUGUUUUCUAAUAUACAGUGAGAGAAUGUGACUGAUAAAACCAAUUUUCUUGAGACUUUCUCCCUGGAAAGUGAAUAUAUGUAUUCAUAGGGCCUUCACAAGCACAGACUAACAAGCAAAGAGCUACAUUCACUGGGAAGGAAGACUCAAAAUUUAAAAAUAGAAAAAAAAAUGAUGGCCCAGAAGAGCAAGUUCAGAGUGCUGUUCAUGAGUGAUCCGCAUGGGACCGCGAUGCCUCUGACGUCUGCCAUCCUGGAGAGCAGCAGAGCGUCACUAGCAGCCAAACAGGAAGACAAGUGUUUCACGGACAUAAGAAAUUUAAAGUGGAAGCACUUUCUAGAGCACACAAAACAGCCUCCCUAACACAUGAGAAGUCACCAGCAACACAGAAAUCACCAACAAGUAGGUCACCACAUUUUUAAAGAUCAUAGGAAAUUGUUCACGCCAACAAAUCUCAGUGAACCUCAGCUCUCAGCCUUGAAAACAAGGAUGGCUGUACUACUCACUUUUUUCUUCUUCUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications