Mus musculus (house mouse) microRNA mmu-mir-379 precursor URS000075B470_10090

• 66 nucleotides
• 6 databases (ENA, Ensembl, MGI, miRBase, RefSeq, Rfam)
• Found in 7 other species
• 606 publications
• 1. transcript
  2. pre-miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGUUUUUGACCUAUGUAACAUGGUCCACUAACUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

1. Cricetulus griseus (Chinese hamster) microRNA mir-379 (ENSCGRG00000021820.1, ENSCGRG00001002212.1)
2. Mesocricetus auratus (Golden Hamster) microRNA 379 (ENSMAUG00000006914.1)
3. Microtus ochrogaster (vole) microRNA 379 (ENSMOCG00000007831.1)
4. Mus caroli microRNA 379 (MGP_CAROLIEiJ_G0007260.1)
5. Mus pahari microRNA 379 (MGP_PahariEiJ_G0007651.1)
6. Mus spretus (algerian mouse) microRNA 379 (MGP_SPRETEiJ_G0007605.1)
7. Neotoma lepida (desert woodrat) mir-379 microRNA precursor family

Publications Download

• FASTA
• JSON