v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PLCE1 antisense RNA 1 (PLCE1-AS1) URS000075B3D1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PLCE1-AS1: PLCE1-AS1 is a long non-coding RNA (lncRNA) that has been studied in various contexts. It is one of the two genes (PCBP2 and PLCE1-AS1) with logCPM above 0, indicating higher expression levels [PMC8172583]. PLCE1-AS1 is involved in DNA recombination, along with other genes such as ZNF667-AS1 and LYRM4-AS1 [PMC8750853]. In a study on mesenchymal stem cells (MSCs) co-cultured with CD14+ monocytes, PLCE1-AS1 was found to be downregulated [PMC6636070]. Furthermore, PLCE1-AS1 was identified as an independent prognostic indicator of recurrence-free survival (RFS) in hepatocellular carcinoma (HCC) patients [PMC7108035]. It was also included in a risk scoring system to predict RFS in HCC patients, where higher expression of PLCE1-AS1 was associated with better RFS [PMC9080350]. In this system, the expression levels of other lncRNAs such as AL158839.1 and MIR7-3HG were also considered for risk assessment [PMC9080350]. Overall, PLCE1-AS has been found to have varying expression levels and prognostic implications in different contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGGUACAGAGACUUUAUCUUUCACACAGACUUCAAAUAUCUUUGGGAAUUUGUGCUCCUUAUUUACUGAGUGCUUGAGAAGAAAAGACAAAGCCAGUGGAAUGGUCCGAGUGUGGCAUCCGCUGCAUUUAUAAAGAAUAAGAGCUGCAGUGGGUGUGAUUCUUGGACAGAGUGGCGCUCAUCCUUGUUCCUGCAAUGAAGGACAUGCCAGCCUCCAGGCUCUUUGACAGAUGAUUGGAACUGUGCAAAUAUUAUGGAAGAUACCCCGUGUCAAGAAGCUGACAGCACACACGUUUGGGAAGGAUUUAGUGGCUGAAGCACUUCUAGAAGACAUCACCAAAAUGAAACAGUCUACUAUCAGCAAAGAAUGCCAGAGCAAGAGUGUGAAACAGAGAGCACAGAGCCGUGAUGCUGCCCCCUGCCGGUGGUGCAGGAGAAAGGACGCAACCUCAGUCUACGACUCCUGCCAAGAUUAUCAGCCACGCUAGAAACUAAAGGGUGAAAACAGGGUUUCUCUGCUGCAAUUCCAUCUCUUCCUCUAGAAACUUGUCGUAGGAAUGACUCCCUGUAACUUCCCACACCUGCCUCUUCUUUCUGUAAGUGUUGGCUAACAGAAUCCCCUCCUUCCUCGGUCCUUGCUAAGUGACUGAAUUCAGAAACUCCUGGACAAUAUUACAACCAUCCGUAUUACUGGUCUUUGGCGCUCUAGACUUAUUUUAGAAAGAAAAAUGUGGCAAAUCAUCCAAGAAUUUUCCUGUGCACAGCAUAGGGAUCUGUUUCUCUUACCAUCAGAAAGGGAUUCAUAGUCAUAAUCAUAUUCGUCCUCCUCAUCUUCCUCUUCCUCAUUAUUGGCAGGUCGGGGGUUGGCAUUCCCACCAUUAUAAGCCUGCACUUGCAUAGAUGCUAACUGAUGAGCCUGUAAAAUAGCAAUAAUUGUAAACUGCAGAUGCCAAGUUAAUGAAUUCAUUUAUAACCUUUAAAACUACCCCUGAUGUUUAACACAAUCGUUAAAAGUGGCUUAACCUAUUUUGAUACAUUUGGGAGAGGAGAAAAAAAUCUAGAUUCCCUCGAAAUGCAAUGUCAACACUUGGGUGAACGUUAGCAUUCCUACAGGAAGAAUCCUGGAGCUUUUAUAAACAAUCUCCAGAAGACUGUGUGCAGUGCCCAGCUAGCCAGGUUCCCAGGACAACCCCUCCAAGAGAAAGCUUUGGUGAUUUGGAGAACCAGCAUCAAUCCCAAGUGACUGAAGAAGUGAAUCACCCAUCAAUUUUUCAGAAGUAUGUCUCUGUUAAGAAACCAUUUUUUCCCCUUCUUAAAAUAAUAUCUACAGGCUCCUGACCUUGAGAACAAUAUUAGAAUCCCUAUGGACAAAGAGGCCAAAAGAAUUGUUGUUGGUUUAAAUAAAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications