v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SNCA antisense RNA 1 (SNCA-AS1) URS000075B38D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNCA-AS1: SNCA-AS1 is a long non-coding RNA (lncRNA) gene that is annotated in public databases and confirmed by FANTOM CAT as an antisense lncRNA gene [PMC6614138]. It is located at the 5' end of the gene [PMC6614138]. There is evidence of colocalization between the association signal at the SNCA locus and an expression quantitative trait locus (eQTL) that regulates SNCA-AS1 expression in the brain [PMC7946812]. This colocalization suggests a potential functional relationship between SNCA-AS1 and SNCA [PMC7946812]. The eQTL analysis showed a high posterior probability of 0.96 for this association [PMC7946812]. The findings indicate that SNCA-AS1 may play a role in regulating the expression of SNCA, which is associated with Parkinson's disease [PMC6614138] and other neurodegenerative disorders. Further research is needed to elucidate the exact mechanisms by which SNCA-AS1 influences SNCA expression and to explore its potential as a therapeutic target for neurodegenerative diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGAAAAACCAAGAGAGCGGGCAGACAGAUUUUAUGUGAGAGAAAAGUUGGAUGCUCACGCUCCAUGGAGCAUCCUCGCGUUUCCCGGGGAAAAGCGGAUCCCGGAGAAGCAGCCUAAUCUCUCAGCCCUUGUGGAGAAGGGAAUAUCAGAAGCAGGACGAAAGCCAGGUCAAGUCUCUUUCCUUAGGCUCCCCAAAGGGACAAGUACUCACCUCCCAGAGACCUGGCCCAGCGGGUCCUCAUGGCAGCACCACCCCCUCCCGGUGCCCACGACCAUUCGUCUCCCAUCCGGCGUUCUCCAGGAUUUCCAAAGACGCCCGUUUAGAUCCACAGAGCUGGAAGACAGCUGUUCCUGGAUCACACCAGAAUGGAGAAGCAAGCUCCUCCCACUAGCAGAAAGCCUUUGCUUUCUGUGCCUGGAUUCGGAAGAUUAGUUAAGCACUGGAAGAGGAGGGGGGAAACAACAACUCGUUUUUGCUUUUUAGAAAGAAAAAAACACAUUAAUGAGCCCAAGAAAUACACGCAACUCUGCAACUCUGUAGAUUUCCACCUGUUCCCAUCCUCCACAGUCUCCCAUCCCACCAGCAACACACGUGAGAUAUCUGAUGCCUUCCCAUCAAUAACUCUCACUUAGUAUGGGUAAGCAAAAAAUUUCCAACCAGGGAUGGAAGUUGUGGAGAGAUAGAGUGGGAAAGCUCAAGGAGCAUUGAUAGGGAUCAUUAAUUAAAAAUCUACCAAACAUCUCUUUCUCUCCCUAAUGUGCGAGUUACAAUAACAUCACUCAAAGCAGUUUGCAGCCACAGCUUGAAGAAAUACAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications