Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1088 (LINC01088) URS000075B361_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01088: LINC01088 is a long non-coding RNA (lncRNA) that has been studied in various cellular contexts. In glioma cells, the cellular localization of LINC01088 was confirmed through fluorescence in situ hybridization (FISH) analysis [PMC9162022]. Further bioinformatics analysis and luciferase reporter gene experiments revealed that LINC01088 competes with miR-95-5p as a target [PMC9228637]. In a rescue assay, the growth and invasion trends of cells were reversed when SNRPA was knocked down in LINC01088 over-expression cells or when SNRPA was overexpressed in LINC01088-downexpressing cells [PMC9162022]. Additionally, the down-regulation of LINC01088 was found to be particularly significant [PMC5811426]. In non-small cell lung cancer (NSCLC), three lncRNAs, including LINC01088, were shown to directly interact with EZH2. This interaction led to increased binding and methylation of the p21 promoter, resulting in the silencing of p21 expression [PMC7549371]. In summary, LINC01088 is an lncRNA that has been studied for its cellular localization in glioma cells and its competitive targeting of miR-95-5p. It has also been implicated in cell growth and invasion through its interaction with SNRPA. Additionally, it plays a role in NSCLC by interacting with EZH2 to regulate p21 expression. These findings highlight the diverse functions of LINC01088 across different cellular contexts. References: [PMC9162022] [PMC9228637] [PMC5811426] [PMC7549371]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGCCUUGCACUUAGGGAAGGUUCACAUGCCUCAAGGAUCUCUCUCUCUCAGAUUUCUUGACUUUCCCUCAGUCUUCAGUAUAGUCCUCCUCUGUGCCUGGUGAAGACCUGUGGUAAAGUGCUGGCAGAGAGGAAGCUAAAUCACGUAAAAAUUAAGAAACAGCUCAGCGUUUCACAGCUAAGCUGCCGGCUUCCCCUUGAAGGAAUAGGAGUAGACCUGCUGAACUAUCACAUGAGAGAAGAGGCCCAAAAGCUUGCACACUACAGUCAAGCUGGCCCUUAAAGAGAUGGACCUAGAAGAUGCUGAGCCAGAUGUACUCAAUUACUUCUCCAAAAUUCAUCAAUUAGAACUGCUUCUUGCUGCCGCCAUAUGAAGAAGGACGUGUUCGCUUCCCCUUCCUCCAUGAUUGUAAGUUUCCUGAGACCUCGCCAGCCAUGCUGAACUGAAUACAACAUGUUUAAGACCACAGAACAUCUGCAUAGGCUGUAAAUUUCGUUGAAUGAUGGAUGCAAAGAUGGAAGACAGAUGGAUAGAGGAAAAGACAGAAUCAGAUACUGGAUGAGUUAGUACUGCUGCCUGUGCUUCAGAGCUGUCUUAUUACCACAAGGCCGGCAAGCAUCAAUGUCCCCACAUCCCCCUCUGCCUCCCCCUGAAAUGUACCGAUUUAUAUGAAAAUUAAGAUUACAAAUUAAAGCCUGGCUAUCCUGGAGUUUUCCAGUUCAUCAGCCAUCCAAUAAAAAUGAUGUCAAGCCUGUAUGCAUAAUUCCCGGAAGAUUACUUUCGUCCUUACAGCUAAGCCCUGUCCCUGAUAUGAAAGAUCUCUAUCCACUUUUAUUGAAAUAAAGAACUAACAUCAUAAUCCCAAUAUUGAGGUAUAAUCUUCAUUAUCUCCUGACCCUCUUGAGGUUCCCCCAAUCUAUAUUACUUCAGAUUUGGUUUAUGUGUAAUCCUUAUGUAUUUACUUUUAUUGAGAUAGGAUUAAAAACUAAAAAAAAAGCUUCAAAAAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications