v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) C10orf71 antisense RNA 1 (C10orf71-AS1) URS000075B248_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

C10orf71-AS1: C10orf71-AS1 is a downregulated long non-coding RNA (lncRNA) that competitively binds with hsa-miR-130a-5p to regulate the expression of COL4A4, potentially influencing focal adhesion, ECM-receptor interaction, and the PI3K-Akt signaling pathway [PMC9119753]. It is one of the seven prognosis-related lncRNAs identified through univariate COX regression and LASSO analyses [PMC8214847]. Among these seven lncRNAs, C10orf71-AS1 ranked fourth in terms of node degree [PMC9119753]. The downregulation of C10orf71-AS1 has been associated with its competitive binding with hsa-miR-130a-5p to regulate COL4A4 expression [PMC9119753]. The dysregulation of C10orf71-AS1 and other lncRNAs has been implicated in various biological processes and signaling pathways [PMC9119753]. Additionally, the expression levels of C10orf71-AS1 have been found to be associated with prognosis in certain diseases [PMC8214847]. In a study examining survival rates, C10orf71-AS1 was one of the lncRNAs that showed a significant association with patient outcomes [PMC8214847].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGCCCAGAGCCCUGCUGAUGUCCCGGGGCAGAAAUAGCCCGUUUCAUCAUCGGCUCUGGACGACCGCCGCCCGCAUUCCUCGAGUAAGGAGCCGUCCUCUGCUGUGCUUUUGGAGCAGAAUAAUCUGCAGCUAGGGGAAGGCCAGGCUGGGUCUCAGGGUGAGAGUUACAGAAGGAUAUGAAAUAAUCGGGGAAGAGGCAAGUUACAGCGGGUAUCCUGAUGCAGACCAUCCCCAGCCAGAAACACAGCCGCAGAACUGAGCCCAAGCUCCAGACCAAAAACUGAGCCCAAGCUCAGGGUCUGCAUGGCCCAGAGCUGGCAUCUGUCCGGGGGACUGGCCCAGGCAAAGUGACCACUGUCAUCCAGUCCAGGAGCUGUGAGCUGCAUGGAAAGAAUGUGAAUGAAGACACAACUCUAAAUGUGGAACCAUGGACGCUAUGUGAGCCAGUGUGCUCCCUAGCCGUCCAGAAAAACAAGGCCCACUUGUACAUUCUGCAAGAGCAUAAAUAAAGCUGUCCUCAGGCGGCGUGCUGUGGUGGCCCAUCCUUGCAGUGGCUUCACUGGCUGCACCCCUCAGCAAGGCCUCUGGAACACUGUGAGGGCAGCACACCCACCCAACAGCGUGGGUAAAAAACGGUCUAGCUAUGGCCUUGCCGCACGUGGUGAUCGCUAACUUAAUUUUGCAGCAAAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications