Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-370 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-370 precursor URS000075B235_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR370: MIR370 is a microRNA that has been implicated in various cancers, including head and neck cancers, PCNSL, GC, and lung cancer. It has been shown to affect the prognosis of PCNSL patients and is considered a potential therapeutic target [PMC9428130]. In GC, the overexpression of MIR370 has been found to enhance cell proliferation, EMT, and invasion through the downregulation of UQCRC2 levels [PMC7378919]. MIR370 has also been shown to be regulated by IL-6 and DNMT1 in the context of GC [PMC5885281]. In lung cancer, MIR370 has been found to inhibit proliferation, angiogenesis, migration in vitro and growth and metastasis in vivo [PMC5675699]. It has also been shown to target EGFR expression [PMC5675699]. Additionally, MIR370 is involved in hematopoietic development and leukemogenesis by targeting FOXM1 [PMC7565099] [PMC6213964] [PMC3533721] [PMC9454643]. It is regulated by distinct gene expression programs on different chromosomes [PMC7565099]. Furthermore, MIR370 is known to downregulate the expression of MGMT through sequence complementarity with its mRNA [PMC7958331]. References: - PMC5354851 - PMC9428130 - PMC6158169 - PMC4998167 - PMC7378919 - PMC5885281 - PMC5011744 - PMC9373174 - PMC7565099 - PMC8065645 - PMC6183594

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGACAGAGAAGCCAGGUCACGUCUCUGCAGUUACACAGCUCACGAGUGCCUGCUGGGGUGGAACCUGGUCUGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications