Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-302e precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-302e precursor URS000075B201_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302e: Experimental results showed that Hsa-miR-668-3p was highly expressed in docetaxel-resistant strains, whereas six miRNAs (hsa-miR-134-3p, hsa-miR-206, hsa-mir-302e, hsa-miR-340-5p, hsa-miR-487b-3p, and hsa-miR-767-5p) had low expression [PMC8656228]. This study suggests that hsa-miR-98-5p, hsa-mir-302e, hsa-miR-495-3p, and hsa-miR-613 in plasma can be used as radiosensitivity indictors in NSCLC patients [PMC5080326]. A study indicated that hsa-mir-302e is a negative expression regulator of the ORX1 gene related to oxidative stress [PMC9138494].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGUAAGUGCUUCCAUGCUUCAGUUUCCUUACUGGUAAGAUGGAUGUAGUAAUAGCACCUACCUUAUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications