Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) OXCT1 antisense RNA 1 (OXCT1-AS1) URS000075B18B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

OXCT1-AS1: OXCT1-AS1 is a long non-coding RNA (lncRNA) that has been implicated in various cellular processes [PMC8973740]. It has been shown that miR-886 can reduce the enhancing effects of OXCT1-AS1 on cell proliferation [PMC8973740]. In glioblastoma (GBM) cell lines, the expression levels of OXCT1-AS1 were found to be upregulated compared to normal human astrocytes (NHA) cells [PMC8028723]. Furthermore, OXCT1-AS1 was found to interact with LEF1, as demonstrated by RNA pull-down assays [PMC8318766]. In the context of retinoblastoma (RB), several differentially expressed (DE) lncRNAs were identified in small extracellular vesicles (sEVs), including OXCT1-AS1, which was classified as an antisense DE lncRNA that can regulate its own sense gene expression [PMC9454787]. The localization of OXCT1-AS1 was found to be enriched in the cytoplasm, suggesting its involvement in metastasis through a posttranscriptional-dependent mechanism [PMC8318766]. Increased expression of OXCT1-AS1 was associated with poor median survival in GBM patients [PMC8028723]. Additionally, knockdown of OXCT1-AS1 resulted in decreased expression of CDC25A, which could be partially reversed by inhibiting miR-195 [PMC8028723].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCGCGCGCUUCUUUAUCGCGUCUCGCUCCAUCAGGGAAGCGACUGCAGAACCAAGCAAAGGCGGUCAUCCGAGGGGCCGGCGAGGCCAGGAACGCGUCGCCGCGUGUCCGUGACCAGGGCACCGCGCCACGGAUGCCAGAUCCCAGGCUGGAGAGAGCGGGUUGCCCCAGAUCCGCGGGCAGAGGCGCAGAGCCGAAGCCCGGAGGAGAGGAGUUUGAGAGCCGCCAUCUUCGGGCGGUGAGGCAGGAGGAGGAUCUCCCGCCAAGCUUGUUGCUUUUCCAAGUUAGUGCCUGGCGUGUGUGUGGGCUGCAUAGGGGCACCCCUCGAGGCCCCCUUCUCUUCUCCCGCCUGGACUGCGUUCACGUUUCUAACAUUUCUCAGCCCCUUCUCCCCACAUCUGGCCUUGGCUUACAUAGAGUAAGUUUGCUGUGAGCACUUGCCUCGAACUGUCGGUCAAGAGGUGUGAGCAACAAGGCUUGCAGAGGAACAAGAUUAAGACUGGACCUCUGUGACCUGAGUUUAGCACACCUUUUCUUCCCCAUCAUCCAAGUUUGCGAAUUUCGGGCUCUUUCUCGCACUGGAGUCCCAGCAACCCCAGAGAUUACUAAAGAUGCAACCAUAAAAGCAGUAUAUUGCUUUAACCUUAGGCAAGUUAGAUAACUUCCCUAAGCCUCAGUGUCCUCAUCUGCAAAUUAGGAUUGCUUGUGAUACAACGUCAUAACGUUUCUAUGAGUUAAUUCAUGCAAAGUUUAUGGCCUUAUUAUGAGGAGUCAAUAAAUGUUAGGCAUUAUUAUAAGUUUAUUCCAUUGUAGCAGUUCAUUGACAUGGCACGUACAUAUUCGCCAAGCCUUGUCUUUUGACCAACUCCUUGAGGACAUGAGCCACGACUGAUUUCUCCAGAACUGUCUUUGCACUUAGCAGAGUGGAAAGACCAAGUGGAAGCUCAAUAGCAUUUUAUUUGAUUAAGGCCUGACCAAGUUCUGAGAAUGUGAUGUUAGUUUUGAACCAAAGCAAAGCACACAAAAAUUAAAUGAGAUCUUAGCUUCCUUAGCAAAUACAGUAAGGUAAUGAACAGUGAAGAUGCAGUUCAAAGUUUGUCCAUAAAAUCAUUUGCCCUUUCAUGGUAUUCUUUUAACUCUGAACUUUUUUUUUUCCUGUAAAUAUUAUAAUUUUAGUCAAAAUCAGUUAAGGAGUAAGAUACCAAGUUAGACUAUUCAAUUACACUGGAGAAAUUAACUUAUUGCUAGUUGGUAUUUCAACACAUUUUAAGAAGUUGGAUUGGGGGGAAAUUCAAGUACUGUAACUAAAGUCCCAUAACUAGUGAUAAUUUAGCAUAUAGCAGCUGUUGUACCUUUAACUUACACAAUGUGAAAAAAACUAGCAUUCCAAUUGAGUCUGCUUUUCCACUUUUGCCCAUUGCGAUUGGGUCUGCUUUUCCACUUUUGCCCUUCCACAGGGCACAUGAAAUGGAAAAACUGCAUUGGCAACUUUGCCGGUGGUCAUAUGACUGACUCUUGGCUGGUCUCACUUUGUUGCUCUUGGCUGAGGAAGACACAUUUUAAAUGUUGCAUGCUAUGUGACUAAGUCUCCUGAGAAAAUCACCCUAAUUACUGUAUGGUCAAAACACACUGUACUGUAUUUUUGAUGACUGUGACUUCAUUUUAUACUUUUUAAAUAAUGUGCAAGUCUCUUCAACUUGAAUAAAUUAGAUUACAAAUUACAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications