v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cardiac mesoderm enhancer-associated non-coding RNA (CARMN) URS000075B0FB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CARMN: CARMN, a long non-coding RNA (lncRNA) gene, has been associated with glioma risk. Two specific SNPs in CARMN, rs11168100 and rs12654195, were found to decrease the risk of glioma in individuals under the age of 40 (OR = 0.47, 95% CI: 0.26–0.85, p = 0.012 and OR = 0.55, 95% CI: 0.31–0.96, p = 0.034 respectively) [PMC9112042]. On the other hand, another SNP in CARMN called rs17796757 was found to increase the risk of glioma (OR = 1.50, 95% CI:1.02–2.19,p=0 .038) [PMC9112042]. Furthermore, among the ten SNPs identified in CARMN and another lncRNA gene studied in this research [PMC7491086], four SNPs within CARMN were found to be in complete linkage disequilibrium [PMC7491086]. These findings suggest that specific genetic variations within CARMN may play a role in modifying glioma risk among individuals under the age of 40 [PMC9112042]. Further research is needed to elucidate the functional implications of these genetic variations and their potential impact on glioma development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUCAUAUAAGGUAAAAGGCAGAGUGGCCUCUGUGGCCAGGGAGCCGCAGGCAAGGGACUAAGGGGAGGGGGGCUCAGUGCCAGCUGCUUAAAAAUGCCCCUGUGGCAGCGAGGGGCACCAGAGGCUGGGUCUAAUUAGUUGAGAAGCAGUGACACCCCCAACCACUCCCCAAACAGGCUGGCUCCCGUCUCCAGGCCCCAAGGAGCCACACCUGGACCAGACCCCAGGAAAGACAUGUGGUGGAAACCCUACGGCCCUGGAGCCCAAGGAGAGCAACGGCUGUAACAAGUGCACAGGCAAGGGCGCUAGCUGGUGGGAGCCACCCCGCCAUGCUGAUGUCAGAGAAGCAAGAACUCUGGAGAAGCAGCCUCCUGGGACCAGAGGAGGGCCAGCAGCAGGCAGCCCGGAGACAGAACUCUCACCCACGCCUCUCCAAGCCUCCCAACAGAAGACAGAGGUCCCCCACAGCCAGAGACAUUUCCUGAAGACAUGGGGAACACAGAGGCAGAAACAGCCCAUCCACCCAGGAGCUGUCCCCCACACUGCCGGGAGCCGGCACCCAGAGCCGCCAGGUAAAACUGAGGCCACCUGGUUCAACAUCACCUUUCACAGAAGGGGAAGCAGCCACAGAAAGAAGGGCCUCGUUAAGAAGUGGAACCUGGGACCCCCAAGCGGUGUCUCUCAUCCUGACUGGGGAUCCAGAGUAGGAGGGAGCCUUUGGUGGGGUUGGAGUCCCGCCACAGGCCACCAGAGCGGAGCAGCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGCCAUCAGCCUGGAAGUGCCUGGCUGGUGGGCCUUCUUGCAGUAGCUUCCCCUGGAGAAGAGGAAAAGCAAACCUUCAUUGAGACCCAAGCGGUCUCUCCUGUGCUCUGUGACAAUAAUAAAGUUCCAGCCCUUGGCAAAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications