Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1471 URS000075B0BA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1471: Hsa-mir-1471 is a microRNA (miRNA) that has been identified in various studies. It has been exclusively expressed in microvesicles (MVs) from fibroblasts and tears [PMC8000192][PMC7564365]. In early chronic pancreatitis (CP), hsa-mir-1471 was found to be up-regulated along with other miRNAs [PMC5225423]. Additionally, hsa-mir-1471 was down-regulated in aneurysm formation and development [PMC4222264]. In gallbladder cancer (GBC), hsa-mir-1471 was exclusively observed in patients with short-term survival [PMC7238852]. References: - [PMC8000192]: Study on miRNAs in fibroblast-derived microvesicles. - [PMC7564365]: Study on miRNAs in tears. - [PMC5225423]: Study on miRNAs in early chronic pancreatitis. - [PMC4222264]: Study on miRNAs related to aneurysm formation and development. - [PMC7238852]: Study on miRNAs related to gallbladder cancer survival.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGCGUGUGGAGCCAGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications