Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1295b-3p URS000075AF37_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1295b: Hsa-mir-1295b is a microRNA that has been implicated in the protumor process of MACC1 and may serve as a diagnostic biomarker and therapeutic target for cholangiocarcinoma (CCA) [PMC6451803]. In a study, three prognosis-related miRNAs, including hsa-mir-1295b, hsa-mir-33b, and hsa-mir-6715a, were used to construct a competing endogenous RNA (ceRNA) network [PMC6451803]. The study also revealed correlations between these miRNAs and seven long non-coding RNAs (lncRNAs), including COL18A1-AS1 [PMC6451803]. Low expression levels of hsa-mir-33b, hsa-mir-1295b, and hsa-mir-6715a were associated with poor overall survival in CCA patients, suggesting their potential as therapeutic targets [PMC6451803]. Furthermore, the study identified several miRNAs (including hsa-mir-1295b) as prognostic markers for CCA [PMC6451803]. Hsa-mir-1295b was found to be significantly downregulated in colorectal cancer and has not been extensively studied in other cancer types [PMC6451803].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAGGCCACGGAUCUGGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications