Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-377 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-377 precursor URS000075AF10_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR377: MIR377 is a microRNA that is overexpressed in GH-, TSH-, and PRL-secreting adenomas [PMC7652879]. It has been shown to influence myocardial regeneration and angiogenesis by targeting genes involved in inflammation, oxidative stress, and angiogenesis [PMC7527411]. Additionally, MIR377 has been found to regulate metastatic capability by inhibiting the process of epithelial-mesenchymal transition (EMT) and inactivating the Wnt/β-catenin pathway [PMC9212183]. It has also been implicated in gastric cancer cell proliferation [PMC5795907]. MIR377 interacts with various genes, including NEAT1, pseudogenes (RPL7P27, RPL7P27, RP11-618N24, SPCS2P1, RP11-209D20, RPL27AP5, MTND2P28, RP11-618N24, NSUN5P1, FTLP10), miRNAs (MIR204,MIR449A,MIR506,MIR335,MIR181D,MIR107), protein-coding genes,rRNAs ,snRNAs ,and tRNA [PMC9730017]. Furthermore,it is upregulated after IFN-γ stimulation [PMC8010072]. MIR377 has also been studied in the context of glioma-conditioned endothelial cells (GECs) and its possible regulatory relationships with piR-DQ590027,MIR17HG ,miR-153,and FOXR2 on the permeability of glioma-conditioned normal blood-brain barrier (BBB) [PMC6180493]. Additionally,luteolin treatment downregulated MIR377 expression in glioma cells[PMC4791268]. Overall,Mir377 plays a role in various biological processes including adenoma development and metastasis regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAACUUUUGUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

2D structure Publications