v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 944 (LINC00944) URS000075AEB0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00944: LINC00944 is a long non-coding RNA (lncRNA) that has been studied in the context of renal cancer [PMC8957844]. QRT-PCR primer sequences were used to analyze the expression of LINC00944 in renal cancer tissues and paracancerous tissues [PMC8957844]. The study found that LINC00944 was highly expressed in renal cancer tissues [PMC8287069]. Additionally, knockdown of LINC00944 was shown to significantly promote Akt phosphorylation in renal cell carcinoma (RCC) cells [PMC8287069]. These findings suggest that LINC00944 may play a role in the development and progression of renal cancer. Further research is needed to fully understand the mechanisms by which LINC00944 functions and its potential as a therapeutic target for renal cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUGCCGCAGCACACUCUCUAAUCGAGCUGUAACACUCGCCACUGCCGUCCACGGCUUCAUUCCUUGAAGCCGUGAGACCACGAACCCUUCGAUUGAGAAGAACCUUCGGUCGGAAGAAGACUUCUCGUCUCAGUAACAAUAACAAGAAAAACAGCCUAGACUAGACGCACAUCAGGAAGACAGUUAAUCCCGUCAUGUAUUGACCCGGAAACAUCAUCUCAUUUGCCUAUAAGACAGAGAGAGAGAAUGAUAGAAAUGCUGGAAGAACGAGCCUUGGGGCGGUAUCGCCCAGAUCUGAAUCCACACAGCAGCUGCUUCGGUCCCUGUAACUCAAGGCUUCCUCUUAAUCCUCUGUCCUCCAUCAACACCUGGCUGAGCAGGAACAACUAUGACCUAGGACCAGGGCCUUCAGGAAUCUUCACCCCUAACUUGAACUUCAUAACACUGGAGAGAGAGACUGUGGAAUGGAAUGACUCUCCAGAGCUGCAGAUUGAAGGCAUAUUUUCAUCUGACUUUGAUCUCAAUGGCGGGAACACCUUCAUGGCCCCUUUAUAGCUGGUAUGUUUUCUUCUUAUGGACAAUGAGAAACAUGUAAUAAACUGUGUUUCCUUCUCGCUAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications